Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1410
Contig Information
Length 1304 bp
Tissue Shoot with ABA treatment
Clones 11 Clones [Download: CSV  ,  FASTA ]
whva11d19    whva11m06    whva11m17    whva17h22    whva2h01    rwhva17h22    rwhva11d19    rwhva11m06    rwhva11m17    rwhva14f22    rwhva6l18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0357000 [Oryza sativa (japonica cultivar-group)] >gi|38637503|dbj|BAD03757.1| putative wound inductive gene [Oryza sativa Japonica Group] >gi|113623593|dbj|BAF23538.1| Os08g0357000 [Oryza sativa (japonica cultivar-group)] >gi|164375539|gb|ABY52937.1| putative wound responsive protein [Oryza sativa Japonica Group] >gi|215740930|dbj|BAG97425.1| unnamed protein product [Oryza sativa Japonica Group]
Score 984
Evalue 4.97527e-155
Total Hit Count 236
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1410
GGATGGAACTTACATAGATTAGTTCTTACTTTCTGAATATTAGTCTGAATTTACAGAAGCTACTTCTCAGGGCCTTGGAATATATACGTCTAATTACATC
AAACCATACGGACCAATCATCTCCATTGCATAGTGAGGTTGAGGACACTTTTTTTTATTTACACAGTCCAAAGTGGCCAGTCTATTGCAGGGCGGGGGGT
AATCACAGTTCTACAAAGGGACGACAATATGATACAAATAGAGTACCGAGTTAAGAACCTTTCAGGCCCAGTTCTTCCGCTTAGATCTCAGCCTCATTAG
TTTGTCCTTCCATGTTGCTGCATCTTTGTATCTCTCTTCAACAACTGCAATGAACATGTTTCGCACCAAACTAAACTCTTGAGCTTCAACGCAGGGCTCT
CCATCAGGTCTGTCAAGTTCAGTAAACAACAAACCATCTGAAAGGCCACCTGTGGCCACCAATTTTGCTGGCTCGACTGATCTTATGCCGTCGCTGTATG
CAAGACTCCTATGTACTTGTATAGGAACCTTGCAGCGAACAGCAATATTGATAGCATCCGAAGGCCGAAGATCAAATGTTATACTCTCTGTTTGATCTCC
AATCTTTGTTAGATAAAGCTCGGCACAGTATGCTTCTTCAATTCTTTTGTTTACCCGAACAAGTTTTACCTCATAGCCCATCTTATCGATCAGTTCCTTA
ACAACTTGATATATTGTAGGTCTTGCAATATGAACATGGCGAATAGCAGCCATCAGAAGTACACTTGGCATCTCCAAAACAATGATTGGAAGTAAAGTTC
CACTTCCATCTTCAATTCTCAAAACGATAGCAGGTTGTGGTGCACTCTCTGGAATCTCTCTCCCTTGAGAATTATTATGCACACACCGCAGGGTTTTTCC
CATCTCGCATCTTTACTATATATCCTTCTGATCCACTTCTGACCTCAACAGCTTCAAGCACAGTGGAATTAACATAATCTTCATCATTTTCATTGAAGTT
TCCAGCCATGTATCCATTACCATCAGATGAGGAGCTGAAGCTATGACAAATAGGACCAAAGTTCTTTGAAGATGACTGAGAGATTGGAGAAACTAGTCTA
GTAATGTTGCGGTATTTAGACACAGCACCCGAGAATGCAGTGCCAAGCTGCCCAGATTTGATCAATGAGTTGTTGACAAGGGCAGCAGGAAGCCTTGCTT
GCATTATAGGGCGACAAAGAATTGGTCCCTCCATTGCCATCAATGTGCCACCAGCAACGGCCGTTCCTCGGAATCGAGCACGAGCGCAACCCTTTTTTTA
GGGC
page-top