Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1396
Contig Information
Length 865 bp
Tissue Shoot with ABA treatment
Clones 9 Clones [Download: CSV  ,  FASTA ]
whva11g05    whva16p05    whva8j10    rwhva16p05    rwhva11g05    rwhva6i09    rwhva6i10    rwhva8j09    rwhva8j10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195619630|gb|ACG31645.1| polyubiquitin 2 [Zea mays] >gi|195620202|gb|ACG31931.1| polyubiquitin 2 [Zea mays] >gi|195620238|gb|ACG31949.1| polyubiquitin 2 [Zea mays] >gi|195620732|gb|ACG32196.1| polyubiquitin 2 [Zea mays] >gi|195620942|gb|ACG32301.1| polyubiquitin 2 [Zea mays] >gi|195628320|gb|ACG35990.1| polyubiquitin 2 [Zea mays]
Score 677
Evalue 3.56912e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1396
TTTTCCGATCATCTTTCTGCATTTAGCCCTACATCAAACTTGAATTCAGGAAAGAGTGGCGAAACACAATCAAAATTCAGGTGATATATGGATCTTACTA
CGCAGCAGAGCTAATAACAGAGGCGGATAAAGTTGCGACTAGCTTTTGTCAAATCATATAGGCAGATAACATGGAAGACAGCCCCTCCCACTAAGCAAAG
CTAGTTTGTTATTATCTCTTTGCAACACCAACACAGGTTCCATGCCACCAATGGTCACTTCTCTCAGGAGGCAAGTGTTTCCATTACAGCTTAACTAGTA
ACCACCCCTCAGAGCAAGGACAAGATGGAGGACCGAGCCACCTTCGATGTTGTAGTCCTTGGCAGTCTTGTCATCTGCAAGCTGCTTACCAGCGTAAATC
AGCCTTTGCTGCACAGGAGGAATGCCTTCTTTCTCCTCAACGCGCTCCTTGATCCTGTCAATCGTGTCGGTGGGCTCAATGTCGATTTCGATCTCCTTCC
CAGTGAGAGTCTTGACCTTGATCATCGTGCCGCCCCTGAGCCTGAGGACCAAGTGAAGAGTCGACTCCTTCTGAATGTTGTAGTCAGCAAGCGTGCGTCC
ATCCTCCAACTGCTTGCCAGCAAATATCAAACGCTGCTGGTCCGGAGGAATCCCTTCCTTGTCCTGGATTTTGGCCTTGACGTTGTCGACGGTGTCGCTG
CTCTCGACCTCGAGGGTGATGGTCTTCCCCGTGAGGGTCTTGACGAAGATCTGCATCTTCCTGCTGCTCGTGCGTGCGGTGCGGGAGGGAGTCAAGCTGC
TGGTCGCGTGAGGACGACGGAGCGGGGGCGGAAGCGGACGAAAACGAAACGAAAATCCTTTCTTT
page-top