Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1386
Contig Information
Length 1391 bp
Tissue Shoot with ABA treatment
Clones 9 Clones [Download: CSV  ,  FASTA ]
whva14d16    whva14k08    whva14k19    whva15f18    rwhva15f18    rwhva14d16    rwhva14k08    rwhva14k19    rwhva6m09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0101500 [Oryza sativa (japonica cultivar-group)] >gi|41052893|dbj|BAD07805.1| putative hydroxypyruvate reductase [Oryza sativa Japonica Group] >gi|41053227|dbj|BAD08188.1| putative hydroxypyruvate reductase [Oryza sativa Japonica Group] >gi|113535120|dbj|BAF07503.1| Os02g0101500 [Oryza sativa (japonica cultivar-group)] >gi|215695322|dbj|BAG90513.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1040
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1386
ATGCAGGGCAGGGCAAACATATAATAAATGCATAATTGATCAAAAATCTCTTGCTTGATATATATACTCATTCATTCATTCATTCAGTACTACTACTCCA
TGAGGATGAGAGCATCCATACATATATACTGGGAAGGAGCTATATATGCATAGCATCTTAGCAAGTAGTAGTAGTAGTAGCAGTGATTCATCCATCTCTG
CCTCTGCCTAAAGCTTGGAAGATGGCAGGCCGAGCTGCTTGGCATTAACGATGCTTGGGCAGGCAGGGGGCGGCGCCGCCTTCTCGTCGAGGAAGGGCTC
CACCGCGTTCGGGTTCCCCCACACCGGGTACCCCTTTATCTTACCAAGCACGTTAAGAGCAGCGAGTGTCGCCATCCCTTCACGCGTCCACTTGGATGCA
GATGCGATGTGAGGCACGACAACGGCATTCTTCATCTCAGCCAGCCCTGGCTTCATGTAAGGCTCATCCTCAAAAACATCGAGGCCAACACGGAACATGG
GATTCGCCCTCAGGTGCTCCACCAGTGCTACCTCGTCGATCACCGGGCCACGGCTCGCGTTCACCAGCACTGCCTCCTTCTTCATCATCGCCAGCCGCTC
TGGGTTTATCAGGTGGTACGTTGTCTTGTCCCAGCACTGGGTGCAGGCTTATCACATCAGCCTCCCTGAGGACCTCCTCCATGCTGGAAGCCCTCTTCCA
TGTCACGGGCTGCTCACCATTGGCTTTCAGGAACTGGCCATACGCGGTGACGAATTTCTCGAGCCGTGTGGACTGGTACAGGTCGAAGTAGATCAAGTTC
ATCTTGAACCCCTCAATCATCATCCTTGCATAAGCTGAGCCGATGCGGCCAGCTCCGATCACTCCAACAGTCTGCCCCTTGAGCAAGTTCCCAACAAACA
GGTGCGGGAGCCATCCGTCGTAGAGGCCAGCCCTCATGAATTGGTCGGCCTCAACGATCCTCCGGGCAGCCGCCACCGACAGCGATGCCGCTAGCTCCGC
CGTCGTCTCAGTAAGAACACCAGGCGTGTTGCCGATGGCGATGCCATTCCTGTTGGCAGCATCTACGTCGACGTTGTTGTAACCGACGGCCATGTTGCTG
AAGGCTGTCCCGCCAGCGCGCTTGAGCGCAGAGAAGAGCACTTCCCCCCAGTCCTCTGTTAGCTGGCCGATGACACCATGGCAGTGATCACCGATGAGTG
CCAGTATGTCGTCGACAGAGAGGATGGTCTTCTTCTCCGTGCATATCTCGAGGCGGCAGTCGTTGTCAGTGAGGAGCTTGATCCAGCGGGTGCCGGGCAT
GGAGCTTGGTGCTCACCACACGGTACTTGCCGCTGGGGTTCCACACCTCTATTGATATCGGCTTCGCCATGGCTGGAGCAGCTGCAAGGAG
page-top