Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1375
Contig Information
Length 896 bp
Tissue Shoot with ABA treatment
Clones 8 Clones [Download: CSV  ,  FASTA ]
whva11g06    whva11g17    rwhva11g06    rwhva11g17    rwhva11g18    rwhva13g13    rwhva5n22    rwhva7f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_019212 [Oryza sativa (japonica cultivar-group)]
Score 641
Evalue 5.67967e-65
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1375
TTTTTTTTTTGATGGAAAACACTCTATGTTTATTGCACTGATGATACTATGCATCAAACCGTTTGTATGGGGGAAGGGGAAGATGAGCAAACTACCAAGG
ACTAAAAGGGCGCATCAAAGCATAAAACCCATGGAGGCGACGATCTCGGGGAGAGAAAGAAGCATCGCAAGCACGACCATCAGTTCGATGTAAACAAATA
CAAAAAACCAGTCCCCAATTTGATCAGGCTCGCCCCCTCCGCGAATCATCTAAGGGGGGCGATATATATCGAATGTAAGACAACGCAAATGGAAAAGGCA
TTGTTTATTACAGGCCTAAAAATACCACTCACGCTCCGACGCAGGCATATCCTCCTCTCCCTCCGTTATTCCAAAGCTTCTGGGCACGAGACCTTCACAA
GTGTGGTGTTTGTTCTTTGGCATCAACGATGACAGAACCTCGCAGAGTGTGCTGATCTTACAGGCTCTTGGCTGCGGCGATGACGTTCTCCGCGGTGATG
CCGTACTCCTTGTAGATCTTCGGGGCAGGTGCGCTGGCGCCGAACTTGTCGATGCCGATGGTCTTGCCCTTGGACCCGACGTACTTTTGCCATCCGAGGG
TAGACCCGGCCTCAATGCTGATCCTTGCGGTGACGGCCTCAGGGAGCACGCTCTCCTTGTACTCATCTGACTGCTCGTCGAAGAGTTCCCAGCAAACAAA
TGACACAACACGGACGGTCTTCCCCTCCTTCGTCAACTCTTCGGCAGCCTTCACGGCAATCTCTACCTCAGAACCAGTGCTCATTATGATGTAGTCAGGC
TTGTTGTCGGTCGAGTTGTCAGAGATGGTGTATCCACCCTTCGCAACGCCCTCAATTGAGGTACCAGGCAGATGAGGAAGCTTTTGCCTGGAGAGA
page-top