Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1369
Contig Information
Length 1259 bp
Tissue Shoot with ABA treatment
Clones 8 Clones [Download: CSV  ,  FASTA ]
whva15c09    whva16g23    whva1h23    rwhva15c09    rwhva16g23    rwhva18d07    rwhva12p11    rwhva1h23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit biogenesis protein [Hordeum vulgare subsp. vulgare]
Score 1388
Evalue 2.29215e-151
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1369
TTTTTTTTTTAAGTTACCGTAAACATATTTGCATTCCTATAAAAGCTAGAAATAACTGATGCTACTTCCTTGCCATTTATGTTTAGCTACTTTACATCGC
AAGACATGTTGGCATGTGCAACAATGGTGATCCTTGTCTAGCGGCTCTTGTTCAGCAATGGCCTACAACTCTACAGTTCACATCACCATTGATGTCGCAG
GGAACAGCTTGTCCAGTAGGGTATAAACACCTCCACCCAATAGAAATGCACCACTGATGGGGTTTATCCATGTGGAATATCTTCTGAATGACAGCAAACT
CTGCAATGCTCCAGCAAAAGAGGCTGCAATGAGAAGAGGTGCAACATAGCCAGTTGTATATGTCAACAACAAACTTCCCCCAACAATTGGATCTCTTGAA
GTGGCAACATATCCCAGAAGGGTAGCAAGAACAGGTGTACTGCAAGGTGATGCTGCTAATGCAAATGTAAGGCCAGCAAGATATGCTTGTACACTGGAAG
GCAAGTTAGCTGCAGCAGCTCGAGGATCATAATCGCTGAAAAATGAGGGAAGTTGTAGCTCAACTACCTCAAGTAGGTTCAGTCCCATGACGATTCCTAA
CCCAGAAGCAGCCACTGGGAGTCCTTGTCCTACTTGCCCATAAGCCTTTCCAGCAAAAGAAGCAGCAACACCAAGGATGGCTAAGGTTGTTGCCAGTCCT
AATGAGAAAGCAACTGAATTTCCAACAACCTCAGCTCGATCTTTTCCAGAGCCAAAAGCACCTATATATCCTAGAGTCAATGGCAGAACACTGAGTGTAC
AGGGAGACAAACTAGTTACAAGTCCAGCACCAAAAATTACTGCCAAGCTGGTGAAACTAAGAGCAGACAACTGATCCAGAACAGCCTCATTAGCTTGCTG
CCCAGCTGAAAATAATAAACCTCCAAACCAATCTCCGATGCCTAAGTCAGCCAAGAGAAGTCCCGATGATCCTAGCAGAGAATCTCCGAGGTCGGCAGCA
TTCGCAGCCCCAGCAGCAACCAGACTCCCCACGGCCACAGATGACAGCACGATCAGGCGCGGGCGGAGGAGCGACCGCCTCACCACGGCCCCCGGCCTGG
CTCCACGAGTCTCTGTCGTAGGCGAGGAGGATGGGGTGGGGTTAGCAGCTCGCGCTGGGAGGTGTGGGCGGCGGGAGACCACGGGGCGGGTGCTCATGGC
GACGGAGAGCATGGCGGGAGGGCGGGATGTTGTCGAGCAGAGGAGAGTGGAGAAAAAGT
page-top