Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1359
Contig Information
Length 949 bp
Tissue Shoot with ABA treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whva15g07    whva19b06    whva9d05    rwhva15g07    rwhva15g08    rwhva19b06    rwhva9d05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloroplast oxygen-evolving enhancer protein 1 [Leymus chinensis]
Score 1282
Evalue 2.93015e-139
Total Hit Count 184
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1359
CATTTTGTGACATTCATGGGGGATCAATATCATGAGTAGGCGAGGAAGAAACAATAACAGAAGCTAAAATATAAACCGACACCCTGGGTTTAGATTACTA
GATACACACACAAACACACATTGTTGCCTCGATTGTTTCCTCTCCACCGATCAACCCACGTACGCATGCACACAAGATGAGTATCTTCACTTCTGCTCTG
CTCTAGTTAGACTCGAGCTGCGCGTACCACACACCCTGGATCTTGACATCCTTGGGCGCCTTGGCGCCGAGGTCGGTGTCTGACGGCTGCACGCTCTCGA
AGACGCCGATCACCTCGCCGGTCTCCGGCTTGCTCTTGGTGACGCTGAGCGTGATGTTGCCCGTGGAGGAGGACGCGTTCTTCACGTTCTCCTTGGCCAA
CTCCTCCTCGTCTCCTCTGCCTCCGGCGGGTAGCGCCACGGCGTTGTCGTAGCCAGTAGAGCCACCACGGCCCTTTGGGTCGAGGAAAGACGAACCCCTG
TAGCTGGGCACGAGGAAGGGCCCGCTGAAGCTCTCGGGCTTGCCGGTGGCGACGAGCTGCTTGACGGTGAAGAGGAAGGGCACGCGCTCGCCTCCGGGGA
GCTGCACGGTGACGGCCGCGTAGTCGATGCCGTCCTTCTCCTCGAACTTGAGGGTGCCGTCGGCGCCGACCTCGAGCGGGCCTTCCATCTCGTCAAGGGT
GTAGGTGAGACGGGTCATGAGCTTGGTCTTCTGGAAGGCCGGCGGCTCGTTCTTCTGGATGCCCTCGGCCTTGACGGTGAAGGAGGTGGGCTCCAGGCAG
AACTTCTTCATCTCGTACTTGCCGGCCTTGAAGGGGAAGGAGTCGACGCCGCCGTCGATGGTCGGGCACTGGTTCGCGGTGCCGGTACCCTTCACCTCCA
TGTAGGTCTTGCTCTGGATCTCGTCGAAGGTCAGCCTCTTGGGCGCCCC
page-top