Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1331
Contig Information
Length 1372 bp
Tissue Shoot with ABA treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whva15f14    whva3b11    whva6k11    rwhva15f14    rwhva6g21    rwhva6k11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27183 [Oryza sativa Indica Group]
Score 1477
Evalue 1.24505e-161
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1331
TTTTTTTTTTGAGAAGTCCTACTTCATCATACACTTTATTTATTTCTGTATACTGAACTAAAGCACATGCAACTCGCATGCCTACCACAGGACGGGTATA
AATATAAGAACTAATGTGTCGAGAACAAAAAATACAATTACACAGGCGAAGCCAGGAATCCTGTACAAGAAAGCAGCAGTTCAACAGGGGCCGGGCCTTG
CAGCCAAGCGTCAGCGAACCAATTTACAGGGGTGGTTGGTTACCTAGGCTGCAAGACCGTGCAGAAGAATCTTCGACGGAATCTGCAAGCTCGTTTCCAG
AAGATGCCTTGGACAGAGCTTCCACAAAATTGCAGCCTTTGGTGACGTTAGTGATTTAGAAGGACCGCGGTCTGAGAAAATCACTTTCAAGTATCGCAGT
AAGAACGCTTAACCTCCGATTAGCTTTGATCATTTTGACGATTGGGCTTCGGCTAGTATCACTTGGCAGATTGTACTGCTGTTTTTTTGCCTGGCAAGTA
CTCTCTCAAACTCAGCACAAGCTTCAGGCGAGTCTTCTTCGCTGGGTGGCACCAACTGCCAGAACAGTGGCAGATATGCCTCCCATTCGTTCAGAATTTT
GGCACCTTTCGTGCTGCCCGTTTTTTCAACATAGGCCTCAATCAAGCCCTTGAGCTGCATCTGCCCAGCTGGAGCATTCACTCTCTGCATCTTGACAATC
TCCTTGTTTACCTTCGGGACTAGTGTATCATCTTCATCTAGCATGTAGGCCAGGCCACCAGTCATTCCGGCTGCAACATTTCTTCCAACTTTGCCAAGTA
CAACTACGCATCCACCAGTCATGTATTCGCAGCAATGATCTCCTGTGCCCTCAACCACTGCTTGCCCAAGAGAATTCCGAACTGCAAATCTTTCTCCTGT
CTTGCCTCTCACAAATACTTGACCACCCGTAGCTCCATACAGACAAGTGTTCCCAACTATAGCAGCATCCTCAGGAACAAATCCTGTATCATCTACAGGA
ACTACAACCAGCTCTCCACCCGCCATACCCTTTCCCACATAATCGTTGGCCTCTCCTACTAGGCGAACATTCATGCCAGGTGTCAAAAAACAACCAAAGG
ACTGTCCTGCACTTCCGGTGAACGTAATGTTCAGCTGGCCTGCAAAGCCTGTATCTCCATACTTCTTAGCAATGGCACCCGCTACACGGCCGCAAACAGC
CCTATCAACATTATAAATTGGATATGTCTTTGAAACCTCTTTCTCGTTCTCAATCGCATCGGATACCTCAGGATCTGCAAGGATTGTCTCGTCAAGAACA
GGGCCATTAGAGTGGACGTCCTGGCTCCTTATCTGAGAGCTGCTCCATTTGGGTAATCCAGCATTCCCTCGT
page-top