Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1318
Contig Information
Length 1133 bp
Tissue Shoot with ABA treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whva15b16    whva3l08    whva6f10    rwhva15b16    rwhva3l08    rwhva6f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0327400 [Oryza sativa (japonica cultivar-group)] >gi|48716905|dbj|BAD23600.1| apospory-associated protein C-like [Oryza sativa Japonica Group] >gi|113631123|dbj|BAF24804.1| Os09g0327400 [Oryza sativa (japonica cultivar-group)] >gi|215697032|dbj|BAG91026.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1457
Evalue 1.96264e-159
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1318
CACGAGGCCTCGTGCCGCAGAAATGGCGGCTTCCTGCACGCTCACCGTCCCCGCCCCCTTCGCCGCCGCCTCCTCCTCCTCCTCCACAGCCCGTCGGTAC
AGGCGATTCGGGGTGGTTGCCATGGCCAGCGTGGGGCAGAAGGTGTACGCGCCCGGCGTGGCCGTCTCCGACGGCAACGGCGGCCTGCCCAAGATCAGCC
TCAAATCCCCGCACGGGAGTGAGGCTGAGATTTATCTATTTGGAGCATGTGTCACATCTTGGAAGGTTCCCAGTGGAAAGGACCTGCTCTTTGTCAGACC
AGATGCCGTGTTCAATGGCCAGAAACCCATCAGCGGTGGAATTCCACATTGTTTCCCCCAGTTTGGCCCCGGTCCCATGCAGCAGCATGGATTTGCCAGG
AATGTGAATTGGTCTATTACTGATTCAGAAGTCACAGAAGGAGATCCAACTGTAACTTTGGAACTAAAAGACGACTCGTACAGCCGTTCAATGTGGGATT
TTAGTTTCCAAGCTTTATACAAGGTTGTGCTGCACTCTACAAGCCTGTCAACGACCCTGAAAATAATAAATACAGACGATAAACCTTTCTCGTTCAACTC
AGCCCTCCACACTTATTTCAGTGCTTCCATCGCTGGTGTTTCAGTGAAAGGTCTCAAAGGTAGCAAGACTCTCAATAAGGATCCTGATCCTAAAAATCCT
CTGGAGGGCAAAGAAGAAAGGGACGAGGTGACCTTTCCAGGATTTGTGGACTGTGTTTACCTTGGCGCACCGACTGAGCTTACACTGGACAATGGATTGG
GTGACAAAATTGTAATCTCAAACACAAACTGGTCAGATGCAGTGTTGTGGAATCCTCATTTGCAGATGGAGGCATGCTACAAAGACTTTGTTTGTGTTGA
AAATGCAAAGATTGAAACAGTACAACTGGGTCCAAAAGAATCTTGGGTGGCAGAGCAGAAAATTGAACTTGTCTGAAGCTAATGGGTTGAGAACAGTACA
GTGCGGCGACGTCAAAGGGCCCTTTTACGTGTCTGGCAGTGTAAACATGTGTCATTCCCCGGTGTACTTCAACTTATGCCCTCACATCAGATGTACATCT
TATAACTATTTTATGTTTTATAAGTAAATAAAG
page-top