Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1314
Contig Information
Length 426 bp
Tissue Shoot with ABA treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whva15e09    whva15g01    whva15j11    rwhva15e09    rwhva15g01    rwhva15j11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit tonoplast intrinsic protein [Triticum aestivum]
Score 305
Evalue 1.29815e-26
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1314
CATGAACCCCGCCGTCTCCTTCGGCCCCGCTGTCGTCAGCGGCGTCTGGGAGAACCACTGGGTCTACTGGCTCGGCCCCTTCGCCGGCGCCGCCATCGCC
GCCCTCGTCTACGACATCTGCTTCATCGGCCAGCGCCCCCACGAGCAGCTCCCCACCGCCGACTACTGAAAACCTCAATCTCATCTCGTCCATCCGTCAT
CGCCATGAGAGATTGAAATCGCTTCAAAAATTCCAGCAAGTGTACGTCGTCGCGTCATCATCAGTAAGCCAGTTTAGTTTCATTGCGCTATCTTGTCCTT
GAGAAATTCAGGGTAAACAGTGTGTGCGAGTCAGTCAGTCAGGAATAATCTCATCCTTCTCTTATCTTGGTGTATGTATGTACGTCCTCAATTATGAATG
CTTCTATTCCATGGTCAAAAAAAAAA
page-top