Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1313
Contig Information
Length 1275 bp
Tissue Shoot with ABA treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whva11f09    whva4k23    rwhva11f09    rwhva13b08    rwhva13p01    rwhva4k23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_04777 [Oryza sativa Indica Group]
Score 1413
Evalue 2.94434e-154
Total Hit Count 123
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1313
ATCTGCTTGCGCCCCTCTCTTTTTTTGTGCATGGTGTGGCATGTACAAAAATTTCAAGTGAAGTTCTGCTAGCATTTCTCTCTATTTTTGGTGAGAGGCA
ATGAGACTGGACCAATAACTGAAGACTTCTGCTAACAACTGTTTAATATAAACTGCTGCTTATAAATTTACAATGCCGGTCGTCGTCACGGCGGCTCATG
GTACCATTACTAACATAAAAAACATCAATTCACCAGACTGACGGCGAAGTGGCTACGGATCCAGTTCACACGCTCACAGGGAGCTTCTCATGCTTCGGAG
GCAAAACTGTCTGTCTTGGTGGACTCCTCCGCATCAGACGGCTTCGATTCGTGCATCGCTGCCGCTTTGAGAACTCGGTCCTGCACCGCCGTCGTGGAGG
GGGACGTCGCCAGGCCAATCTTGTTTGGCTCTAGCTTCTTAGCTGCCCACGAGAACGCTTCCGCGCCCACTCTTACTGGGGACAGCAACAGCTTTAGGTC
TTGCAGGAAATCCTCCGAACCCTCGTATGTAGAGAACCGCAGGTAGATCGTCAACCCAATACTAAGAACACCGATGTACTGCAAAGTCGTCTCCCATTCT
AGCAAAGCATAAGTCACTGCTGAGAAGCCCAGAAGGGATCCAAGGACAAGTGTAGGGGTGGGCTTTATGCCTTCGAGGATTTCCTCAGCATCCTCATTTA
TTACTGTCAATGCAGTCTCTGGTTTCAGTTCTTTCACGCGAAGATTCTTTGCCCAAGATTGGAAACCTCCTTTAACCAGGTAAGGTTGCTGAACACCAAG
CTTCTTCAGCAGCCTAGCAATGGACTTTGATCGGGTTCCATTAGCATCCATAATAATGACCTTTGAATCACCCTTAACCAACTTCAAGTTGCGGATTACA
ACTGCAACCAAAGCATCATCAACTTCGCTTCCACCTTTAAGTAGCTTCTTTGTTGGACCTTTGATCTCAGGCGAAGCAACGCTTGCATATTTAGATCTAG
CTGCACGGCGTAGGTCAGGAATTCCATCTTTCCCCCTCAAGTCCTCAGGCCGAACATCAATAAGTACGGCTTTGCCATCACTTTTCAATAGCTCCAATGT
CGATTCAGGCGACAAATCTCCAGAATAGCCACCATATGCGAAGAGCCAGTAAGATATCCCTATTGTTGTTGAACCTCCAAGCAAAACTGCCAATTGAACA
ATTGGGTCACTTGGGTTCAAACCAACATTCTTTTCGATGCCTTCGATGATAACACGGCACGAGGCCTCGTGCCGA
page-top