Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig945
Contig Information
Length 1420 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10c20    rwhcs10c20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_02943 [Oryza sativa Indica Group]
Score 1025
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig945
TATTGCAGGCAAAGTCGCTCTGACATGGTTCGGCCCGGAGCCGAGGGTGGTGGTGAGCGACCCTCAGCTGTTCCGGGAGATCCTGTCGAACAAGCAGGGC
CAGTTCGGGAAGCAGAGGTCCATCCTCCGGATCGAGCGGCTCTTGGCCAACGGGCTGACCACCCACCAGGGCGACAAGTGGGTCGCCCACCGGAGGATCA
TCAACCACGCCTTCCATCTCGACAAACTCAAGAGGATGCTACCTGCTTTTGCAGCCTGTTCCAGCGAACTTGTGCGAAGATGGGGAGACTCCATGGGGCA
AAGTGATGTGCAGGAGATAGATGTCTGGCCAGAGTTTCAAAACCTCACCGGCGACGTGATATCCCGAGTGGCGTTCGGGAGCAGCTTCAGTGAAGGGAGA
AAGATCTTCCAGTTGCAGTCAGAGCAGGCGCAAAATGCTGTCAAGATGGCAAACTTGATGTACATCCCCGGTTACAGGTTCCTGCCAACAAAGCTCAGTA
GAAGGATGAAGGCAAATGCCCGGGAGGTCGAAGTACTCCTGAAAGGCGTGATCACGAAGAGGGAGAGGGCGATGGTGGATGGCCACGCCGACAACCACGA
TCTACTANGCGTGATGATGGAGTCCAACATAGAAGAAAGCCAGGAAGCCGGAAGCTCCAAGCCGACGATGACCACCGACGACATAGTAGGGGAGCTGAAG
CTCTTCTATTTCGCGGGCATGGAGACAACCGCGGTGCTGCTAACATGGGCAATGGTCCTGCTAAACCATGCATCCCGAGTGGCAGGACCGCGCCAGGGAG
GAGGTTCTGCGCGTCTTTGGGAAGAACCAGCCGGATTCTGAGGGCATAAGCCGGCTGAAAGTCGTGACGATGATACTCCATGAGGTTCTTAGGCTGTACC
CACCGATTCTGCTACTTAGTCGGGAGGCGTATAAAGAGACGAAGCTGGGAGGCGTCACATATCCAGCCGGCGTTACATTTGCGCTGCCAATTGTGTGCAT
TCACCATGATCCAGATGTGTGGGGAGAAGATGTCGACGAGTTTAAGCCGGAGAGGTTTGCTGAGGGCATCACCGGTGCATCCAAGAACTCGCCGGCGTTC
TTTCCGTTTGGCTGGGGACCACGGATTTGTGTCGGGCAGAACTTTGCATTGCTTGAGGCCAAGATAGGATTGAGCGTCATCCTGCAGCATTTAATGTTCG
AGCTCTCACCGTCCTATACGCATGCGCCATGCCCGGTCTCTACTTTGCAGCCCCAACATGGTGCGCATATTAAGCTCATGAAACTTAAGAATTAGCAACC
GTTACCGATTAGCCTCCGGGCTCTGGACAACCATAGACATTGAGAGTAGTCAGGGATTAGGGTGGTGATCTTGGAAGAGACGTAGTATAATGGATCCTGA
TGTTTACATCGAAGGCGACA
page-top