Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1303
Contig Information
Length 749 bp
Tissue Shoot with ABA treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whva11d05    whva8i23    rwhva11d05    rwhva11i05    rwhva7g10    rwhva8i23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 541
Evalue 1.61228e-53
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1303
TTTTTTTTTTAGTGGAGAATGTATATCTTGCTTTGTACTACAAATGTATATTGCACAATTTGCCACAAGATCTTGCTATGTGTACTTGTGTAGTTTCTAC
GGTACTACACTGAAGACTGAAGAGTCCAAGCTTTTCACTCAACTTCAGCGGAGGAAGGCAAGCTGTTTTGCCAATCCATGCATATATACGCTTGGGTCTC
ACGGTTACTTGGCTTCCTCAAGCTCCCCCTCCATTCCCGCGTCCTCGAGCTCCCTCAGCCCTCCGACCCTCTGCTCGATCTCCTCAAGCAGCTCCTCCCT
CAGCAGATCCCCCCTCGCCGTCGCCTCGATGTCCTCTTGCCGGTCGTAGTACCAGTGCACGGTGCCATCACCCCCTTGCCCCCTGTAATACTCGCTGTCG
TAGAATGGATCCTTCATGGACGCGAAGAAGCAGACGCCCCAGACCGTGAACATGGCGTAGAACGTGTAGAAGCTCTTGATGGCCGTGTCGCTGAGATGCC
ATATGGACTTGGTGACCACCCAGTCCCTCTGGTTGTCGACGTGCTCCACCATCGTCACCATCAGCGGCACCACGTCCAGCGGGAACGCCCTCGCCTTCAG
CGCGTCGCCCCTCCTCCCGGCTGGCCTCTGCACTAGGTGCACCGTCGCGGGGCAGCTGCCGCCATTTAGGCCGCTGCTTCTCCCGGACGGCAGAGCGGAG
CAGTGGGAGTGTGGCTTCAGCAACGACGACGCCATTGCTGCTAGGTTGC
page-top