Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1297
Contig Information
Length 756 bp
Tissue Shoot with ABA treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whva11g04    whva11g15    whva4n21    rwhva11g04    rwhva11g15    rwhva4n21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit immature spike ubiquitin-conjugating enzyme 2 [Triticum aestivum]
Score 801
Evalue 1.16433e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1297
GTCCTCGCCGTCCCCAACCTCTCGCTGCAAAAGGTTGCTTGTCATGGCATCAAAGCGCATCCTCAAGGAACTGAAGGACCTGCAGAAGGACCCGCCCACA
TCATGCAGCGCAGGTCCTGCTGGTGAGGACATGTTTCATTGGCAAGCAACAATTATGGGACCCCCTGACAGTCCCTATGCCGGCGGTGTTTTCTTAGTGA
ACATTCATTTCCCTCCAGATTACCCCTTCAAGCCACCAAAGGTATCTTTTAAGACAAAGGTCTTCCATCCTAATATCAACAGCAATGGAAGCATATGCCT
TGATATTCTTAAGGAGCAGTGGAGCCCTGCTTTGACGATCTCCAAGGTCTTGCTCTCTATCTGTTCCCTGCTGACCGATCCCAACCCGGATGATCCCCTT
GTTCCTGAGATTGCCCACATGTACAAGACGGACCGGTCAAAGTATGAGACGACAGCCCGCAGCTGGACGCAGAAGTACGCCATGGGTTGAAGACCTGCAT
CGTGGACAACTGAAATGTCGCTTCAAGAAAAAAATTTATGGGCCATTGTTTCTTCGATTTGTTGCTGGTTGTGTGTAATCCGATCCTCAAGGATTGTAAA
TTGCATTCGGCGTCGGCCCTATCATCAATTGCCACTAGTATCGGCAGACATGCATGCCTATCAGCCTATTCACCTATGCTTGTTGGGTTAACCTTCATCA
GTGTTGGTGTTATTTGGTAAATGTTCATTAAAACATGTTTTGCTTCAAAAAAAAAA
page-top