Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1286
Contig Information
Length 1480 bp
Tissue Shoot with ABA treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whva11d02    whva11o01    whva1l20    rwhva11d02    rwhva11o01    rwhva1l20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09813 [Oryza sativa Indica Group]
Score 1786
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1286
TTTTTTTTTTAGTCTGAACTACCTTTATTCATCTTACGATTCTTAAATACTTCCATACAAAAATAAAGGAAGGCACACAACCCTGGTGCAAACTAAAGCA
CATTCAGGATGCCTGTTAGGCACCCCGTTGCAATATTACAAGGAGCATGTCCGGGAGGGCCTCGTTGTACATGTAATTGTACAATCGCGCTCGGTAAAAA
AAAGGCGCTGTCTTCAACAAGAGACGGCGGAACTGGACCATCGATGCGGTGCCGGAGAAATATACAGTACCCAGCGCCCAGCGGTATCACCTCAAGGGGT
GGTCCATCGATACAGCACCGCAAGATAGTTCCATTCCGCAAAGTATCAATCATCGCGACTATTTCGCAATTGTGTTGGATTCAGTTTTCCACACAATGTC
TTTTAGTTCTGATGAGAAATTCTTGTAGAAACTGTGAAACTCCAAGGTGTCCCCTCCAGTTTTACGAAGTTCAACCATATGGAGTGTTGGAGCAACCTCA
AAAACCTCTGTTGCTACAGATAAATGGCCTTTTCTTCCTGTCTTGTCACCTTTCAGTTTCATCTTATAATTTTGCTTCCGCACATTGAAACCAAGAGGGC
CACAGGCTTCCTCTATTTTAGACATGATCTCTTGTGGTGTACGTTGCGACGCAAAGGATGTTTCCCGCTTTACCATCCCCATCATCTCTTTCTCAAACAA
ATTTCCGAGATTGAACCCCTCCGACCTTGAAATAAGAGCAAATGCATTCATGGATTCTGGTTTCTCTCTTCTCTCCGCCACAAGGTGTTCCTCTGAACTA
TCGAATGCAGCATCGACATCTTCAAGGCTCACATCTTCATTGTGCTCAGACTGTGGTGGTTTATAGTCCTTTTTGAACCATTCATCTTCCAAAATTTGGG
CGATTGTTATCCTCGTGTGAGGATTGGGATCAAGAATGCGCTTAATAAGATTTCTTGCACCGGTAGAAAACCATGGTGGACAAGAAACATTAGCTCTGGC
GATCAATTTATACAGAGTCATTAAGTTGGGATCATCGAAGGGCAAATATCCAGCCATAAGGACAAATAAGATTATGCCACAGGACCACACATCAGCAGCC
ATACCATCATAACCTTTATCAGCAAGCACCTCAGGCGCAACATAATTTGGAGTTCCACAAGCAGTATGCAGAAGTCCATCCTCCTTTGTTTGCGGAGAAA
ATGCGCTGAGGCCGAAGTCTGAGACTTTGAGAGCTCCATATGAATCAAGGAGCAGATTTTCTGGCTTGAGATCTCTATGGTACACTCCACGACTATGACA
ATAATCCACCGCATTTATAAGTTGGTGGAAGTATCGTCTTGCTTCATCTTCTCCCAGCTTCCCAGAATTGACAATCTTATCAAAAAGCTCGCCTCCTTCG
ACAAACTCAAGAACCATGTATATCTTTGATTTGCTAGCCATCACCTCATGCAGCTGGACCACATTGGGATGTCTTATTAG
page-top