Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1255
Contig Information
Length 887 bp
Tissue Shoot with ABA treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whva15f15    whva17k16    rwhva15f15    rwhva17k16    rwhva17l03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_03330 [Oryza sativa Indica Group]
Score 1147
Evalue 1.18101e-123
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1255
GGCAGGATGCACCTGACAGGGATGAAGGTCAGGCTCATGTCCATTTTTACAGATTATAGCACTAGACCTAGTAAATTGCACGCTATGCTTGACAAAAATG
ACTGGCTATGGGATGAAAAAATATGGTAGCTATTCTACACAAGGTTCTGTAAGACTATATTTACAGAGACAAAAACTAAAAAAGAAAGAATATTCCCCTC
GCTAGTTTGGGGTAGAACAATCTGCCGTATCAGTTTTGATAACTCTGGTATTGTAAGAACCACAGGAGACGCATTTGTGGTACAGCCAATGAAACTGAGA
TCTCCCTTTTCTTTCACAGTCATTACAAAGAATGTCCTGACACCTCTCGCGGTATTCCTCGGGAAGCTCTTCAGCAGCCAACAACGCATCAAGCATGCCA
AAGTACACCGCCATATCTCCCAAGGATTTGCAGCAGATAGGACAAGTGTAGTGACTGCAAGTGTATGCCTGAAAGCAAGCTGAATGCATGAAGTGACCAC
AAGGAAGAGCTCTAACTGCCGCGCTTGATGTGAATAGGAAGTCACAGCAGATTGGACAGTTTGTCTCTAGCCCCTTCTCCCGACATTTGTGTTCTGTTAG
TTTCATTCCAAGGCAGCAATTGCACTTCATGCAATGGAAGAAATCAACACCAAGACCTTTACCAAGACGACACAGATTACAAAACGGACAATGGTAGACA
GTCCTTTCGTCATCAAAAAATTTGCAGATATTACAGTAATACTTTGCCATGGATAGTCCATTGCAAGACGGAGTTTGGCAATTCGGACCGACAGGTTGAA
CCTTCAGGCATACCATGCACATCATCTCCTGTGTTGCTTTCCTACAGGCAGAAGTAATGTTGGCACATTTACATTTGATCCTCGTGC
page-top