Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1225
Contig Information
Length 876 bp
Tissue Shoot with ABA treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whva15f16    whva5p16    rwhva15f16    rwhva16e03    rwhva5p16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_01693 [Oryza sativa Indica Group]
Score 798
Evalue 3.38991e-83
Total Hit Count 140
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1225
CTCTTGTATTTCTCTTCGGATACAGTTCTTCCCCTGCGCACACTCTAGTGGCCTTTATGCAGTTTTTACATCAACTGTGAATGAAATTGAAATTCTTAGA
TGTTGAGGACAGTTAATCTTGTCAAGACTGGAGGGACTTACTATAGCGCTCCTTCGCGAACGCCACAAAACGTTCTAGCCCATTGAAAAGTAAACCTTCC
AGAAATGGTTTCAGGGCTGATGCAACCGGGGTCAGAATTTCAGGAACTTCATAGGCCACCGTTAGTTGTACTCTACAAGAAGATGAACTCTTAGGGAAGA
ATCGGACAGCACCCCTGTTAGGAAGACCTTCAAGAGATCGCCAATGAATCTTCTGATTTTTAGTTGGCGTCATGTTCCGGGCAAGCCAAGAAAATTCTAC
ATCCCGACCAAGTATCGCATACTTCAAAGTCCAACGTGAAAGTTCTGGTTTATCTTCAAGGACCTTGACAGTTGATATGAATGGCATCCATTGAGGAATA
GTCTCACGTTCGGAGTAACACTGGTAGGCCACTGAACATGGAACATCAACTTCAATTTCAGTGCTGCACTCCTGCCACTCCATGGCAGGGGAGAACAAGG
CAGGCCTCGCCCTTGCCCTGCTGCTGCTATTGATGCTGCCACAGCTCGCCTTCCCCTCCCCTCTCCTCCTCCTCATCCACCACCGGCTGCTGCTGCGGCC
GCCGCTGCTGATAAAGAACACCTTGCTCTGCGATGACCCGAGGCCCGGAGATAGCGAGGAGGGGCTCCCCCTTCCTGCGGCGGGGTGGTAGTAGCAGGCA
GCTCCGGTGGCCATGGCCGTTGCCCGCTCCTCCCCTCTCTCTCTCTCGTGGCTCGTGACGGTGCGGTGTATCGTTC
page-top