Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig935
Contig Information
Length 835 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10c21    rwhcs10c21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37521 [Oryza sativa Indica Group] >gi|125578547|gb|EAZ19693.1| hypothetical protein OsJ_033902 [Oryza sativa (japonica cultivar-group)]
Score 703
Evalue 3.24035e-72
Total Hit Count 253
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig935
AGGAAAAGATAAACAAGATGAATGCTCGAAACATTGCTATGGTTTTTGCACCAAATATGACTCAGATGGCAGATCCTTTGACTGCACTAATGTATGCAGT
CCAAGTGATGAATTTTCTGAAGATGCTAATAGAGAAGACCCTGAAGGATAGAGAGGAGTCCAATCTGGACGATGTGTCTTTGCCCCAAAAGGACCCGTCT
GATGAAAACGGGCATCATAACCCTGGCTTTGCCGTCGATGCTCACCGTGCGGAAGGATCAAGGCGTCCTTCTTTCTTCAGCGAGGAACCCCTTCTGAACA
GCCCTGCACACAGCACCGAAGACAAGCCTAACGAGACCAATCCTACCGGAGGAGACTCTGCACCTTCTGGCCAGAAATTCATGAACACAGAGGGCTCTTG
TCGATGGTCCCAACCTCTGCCTGCTGCTTCAGCCACCACTGATATTTCCTGTGCTACAACATTGAACTCACTGCAAGGCAAGGGGAGCCGTAGCCTGAAT
AGTAGTAGGAGGACAAGGAAGGGCAAGGGGCAGTCTGCAACGCCCGCCGTCGCTCCGCCAACCGAGAAAAAATCACGAGGTGGAAGCATCGTGAGCCGGT
TAAACTCCACGGTCGAACGGATCGAAGCGTGGAGATGAATGAGCTCAGATGCTACTGTCGACCCTCTTGTGTCGTAGATGACTGACCCGGTGTGTTCCTG
CGTACATGATCGACCGAATTTTGATGTGGTTTTCATTTCCTGTCAGGTCATGATCGTTGTATTCCTTTATTTGATTTGCTTCCACACGTACGCTAACTTT
TGTATCTTGCTTATCAGTTGTACTTCTCACTGTTT
page-top