Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1209
Contig Information
Length 646 bp
Tissue Shoot with ABA treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whva11a22    whva10a22    rwhva11a22    rwhva10a22    rwhva10n06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_022416 [Oryza sativa (japonica cultivar-group)]
Score 631
Evalue 4.40303e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1209
TTTTTTTTTTAACTGACAAGCACAGCATGAATCAAAATGAACCTTCACAATGGAAACAAGATTCTCAGAGCATTTAGGTAGAACAGCTCATTGTGCATAA
CGAAATTATAGCTAAACAGAACCAAATACTAGATATATAACTGGTTCAAAACAAGGGAGACAGCTAGATGGACATGCCACCAGATGGTCCGTACTGAATT
CTTTCAAAGTAGAAAGCGGCATAACTCATTTAAGAGGAATGAACCGGGAAGAGTGTGTGGCACCAATACCGGGCCTACCATGCTTCACTGGCTTGTAGGA
GATAGAGAACTCTGCAAGGTAATGGCCAATCATCTCAGGCTTAATCTCAACCTGGTTGAAGGTCTTGCCATTGTAGACACCGATAAGGCTGCCAATCATC
TCAGGGACAATGATCATGTTACGAAGATGTGTCCTCACTGGCTCAGGCTTCTCACCAGCAGGAGCGTCCTTTTTCGCCTTGCGCAGCTTCTTGACGAGCG
CCATGGGCTTCCTCTTGAGACCCCTCTTGAACCTTCTGCGGGCGCGAGCGGGGAACATCTGGACAAGGTCGTCGGTGGACATGTCGAGGAGGGCATCAAG
ATCCACGCCGCGATAGCTGAACTTGCGGAACGTCCTCTTCTTCGGC
page-top