Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1212
Contig Information
Length 846 bp
Tissue Shoot with ABA treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whva10d17    whva3g23    rwhva15b10    rwhva12a23    rwhva10d17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=V-type proton ATPase 16 kDa proteolipid subunit; Short=V-ATPase 16 kDa proteolipid subunit; AltName: Full=Vacuolar proton pump 16 kDa proteolipid subunit >gi|166549|gb|AAA32712.1| H+-ATPase >gi|108925912|gb|ABG23316.1| vacuolar ATPase subunit c [Triticum aestivum]
Score 570
Evalue 8.80486e-57
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1212
AATATAATCATAAATTTATTATTTAGCTACAATGCATGTTTTTATTCACCACCAAGTAGGATTAAAACCCATATTCCCAGGAGCAGCAATCCAGCCTACC
CCAAAATCCTCTGCACGAACAGCAAACGCCCACCACAACCCAAAAAGAATGAAAACGGTACTGGAAGTGTCACCTTCCTTAATAATCTACAAATATCTCC
TTAATACATCAAAATTAGAAAGCTTCTCAAGAATGTAGCCTGTGTGGCAATTGCAGAATGGTAGAGCGAGGCGCCTAATCCGCACGGGACTGGCCGGCAC
GGGACGAGAGGATGATGCCCACGATGAGACCGTAAAGGGCAAGTGCTTCTGCGAAAATGAGGATAAGGATCATGCCCACGAACAGCTTTGGTTGTTGCGC
ATTAGCCCTGACTCCAGCATCACCGACAATGCCAATGGCCATGCCGGCGGCGAGCCCCGCGAGGCCACAGGCGAGCCCTGATGAGAGGTGAGCGTAGCCG
TCGAAGAGGAAGTAGGGCTTGGCCTTGGGGTTGATCCCGGTGCTGATGATGACGGCGATGATGAGGCCGTAGATTCCGAGCACTCCCGCCATGACGACGG
GCACGATGGACTTCATGACGAGCTCCGGCCGCATGACTCCCATGGACGCCACCCCGACGCCGCTCTTGGCCGTCCCGTAGGCCGCCCCCATGCATGAGAA
GACGAGGGCGGCGGCGGCGCCGAGGAAGCCGAAGAAGGGCGCCGTCTCATCGCCGCTGAACACCGACGACATCTTGCTCTTCTTCTTCTTTCTCCGGTCG
CGCTTCTTTCCTGTTGGAACTCTGGGTGGCCTCGTCGCTAAGGAAG
page-top