Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1203
Contig Information
Length 1115 bp
Tissue Shoot with ABA treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whva11c21    whva5a08    rwhva19k22    rwhva11c21    rwhva11h11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RPE (EMBRYO DEFECTIVE 2728); ribulose-phosphate 3-epimerase [Arabidopsis thaliana] >gi|30697525|ref|NP_851240.1| RPE (EMBRYO DEFECTIVE 2728); ribulose-phosphate 3-epimerase [Arabidopsis thaliana] >gi|4102703|gb|AAD09954.1| ribulose-5-phosphate-3-epimerase [Arabidopsis thaliana] >gi|9757862|dbj|BAB08496.1| ribulose-5-phosphate-3-epimerase [Arabidopsis thaliana] >gi|15027997|gb|AAK76529.1| putative ribulose-5-phosphate-3-epimerase [Arabidopsis thaliana] >gi|20259209|gb|AAM14320.1| putative ribulose-5-phosphate-3-epimerase [Arabidopsis thaliana]
Score 1103
Evalue 2.1599e-118
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1203
AAAGGAAAATTATCTTTCTGTGCTGCCTCTTTTTCCCTATCTGATGATGGTGATCTCTGTGATACAACGTATGGCTTGACAGTGAAAGGCACCTATGCAT
TGCAAACCACGACAATGGTGAAGAAAAAAAAGATGTTACACAGCGTAACAACAAGCTCATACTCCGGTTCTTCATGCTGCTACGGCTACAGGTCTTTTGC
TGGTCTTGATTCCTTTGATAGCTTCAGCATAGTCTTTAGCTCCGAAAACCGCAGAACCAGCAACAAGGGCATTCGCGCCAGCTTCAATGACCTTGTAGGC
ATTTTTGGGGCTGACTCCACCATCAACCTCAATCCAGGGGTTCACTCCCTTCTCTTCACATAATTTTCTCAAATCAGCAATTTTCTTTACTTGGCTCTCA
ATGAAGCTTTGCCCACCAAACCCAGGGTTGACTGACATAATCAATACCAGATCAACAGATTCAAGTACATATTCTATCGCACTGAGTGGGGTCCCAGGGT
TCAAAACAACTCCAGCCTTTGCTCCTAGACTTTTAATCTGATCGACTGTTCGGTGCAGATGGATGGTTGCCGTTTGCTCACAGTGGACGCTAACAATATC
AGCACCTGCCTTGATAAAATCAGGAATTCGCTGCTCAGGTTCCACAATCATCAGATGCACATCCAATGGAAGATCAGTCACTGGACGCAGAGCATCAACA
ATCAATGGTCCAATCGTGATGTTTGGCACAAAGCGACCGTCCATGACATCAACATGAATCCAGTCACATCCTGCCACCTCCACAGCTTTTACCTGTTCAC
CAAGCTTGGCGAAGTTTGCAGAGAGAATGGAAGGGGACACAATGATGTCGCTCTTGGAGAAACTGTCGACCCTTGATGCCTTCACTTGGAATAGCTTCCT
GGACGAGGAGAAGCCGGCGCGGCGGCGGGCGCCGAGGGAGGCGGCGCGCGGGTAGCCGAGGCTGGAGCAGAGCGACGAGGACGGGGACGCCATCTGTACT
GTGCGTGTCCACCAACCAAAACTCTCTCTCTCTCTCTCTCTCTCTCGCTGCCGCTCTGCCTCTGGCGGAATGGAAGGAAGCGCTGGCCGATTTGGTGGGG
GCTACGCGCGCGCGC
page-top