Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1193
Contig Information
Length 1494 bp
Tissue Shoot with ABA treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whva15a02    whva1e01    rwhva15a02    rwhva15a13    rwhva1e01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vacuolar proton-ATPase D subunit [Triticum aestivum]
Score 1843
Evalue 0
Total Hit Count 241
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1193
TTTTTTTTTTGCCAACAAACCATTTGATATCTTGGGTGTACATTTTACATTGCCAACAAACTGCACAAATAGTGCCACCCACTACGAAAATAAACATCAT
TTATTTAGTTTACCGTACAACTGCGCCTTTTATTTTACTACAAAAACAAATAATGATACACTAGTCCAGGTCTAGCTTTTCAGCCGCATAGAAAGAGGAA
CAGGGGTAATAACAAATCATGAGCTTGTAAAGTGTGCAATCGATTGTGCCATCATCAAAGCAGACCTTTTGCACAACCATATGCACAGTAATAGGGGGCG
ATTAAAAGATCGGCACAACGCTGTCGTGGACCCTGTTCTTCTGGTTCTGGGCAACGCATTCCGAGATCCACATCAAGTTCCTTATCTCCTGCTCTCGTAG
CCTCATGTATGCGAAGAAAACAGCGTAGTGGAACTGCTGTTCAAATGACTGGCACAGCCTCTTTACTTCCTCCTCATAAAAGGCCTTGTCCAACATCTGG
CTTTCGCCATATGATATCTTGGCAAAAATAGACTGGTATGGGGGGTACTTTTCCATTACACCACGCACCTGGTCAACATCTTCACAGACAGCCAACTCTT
CATGACCATACGGAAACAATAGACCAAAGTTGGAGTACAGCTTCCGGCGGTCATCTCTAGTCAGCTCAGTACCAATACTGTTTATGGTAATGTTTACAGC
TCTTCTGTCAGCTTCAAATGAAAGGAGATTACACATAATCTCAGCCGTCGCACCACCTAGTTTCGCACAAAATTTGTAAAAATCCTCAAGATACGCTTTG
TAGAGTGTGTTCCTCATGATCTCAATATTCATGTCATCCAGATCCTCAGATGTAATGCACTCTGAGAAGTACGGTGCTAAGGGTGTATCAACTAGAACCA
GCCTGTAAAGCTCACGCATATTTTGAGCAACCGCAAGTGATGCAATGCTGTCAAACATGCCCAATGGATGGCATTTCTCCAACAGTTCGTTAACATCTCT
TTCATGCAATGTCCCAGTAACAATAAGGACAACATTATCGATCATGTGTCCATATGTTATGTACTGTAGGAATGTAGATAGAGGTTCATTCGCCTGGCAC
AACATGTGTTTGTATTCATCAACCAGCTTAAGAGTGCACTTCTCCACAATTGTTGTTGTGTGCAAGGGGGAAGGTTCGTTCTGGAGGTATGGACCGTACT
CGGTGGCGGAGAGGTGCATCTTGATGTCGTCGAGGGTCTCGCACTGGCAGAGGTTGTTGTAATCGGCTTGGGTGAGGAGGCCCGAGCGGTTCCCCCGTAC
GATCGCCTCCAGGAACCCGTCGTGGATGTTGAACGACAGCATCTCCCACGAGTACATCCTGGCTCTCGCCGGAGGAAGGAAGGATCTCGGCCGCGGCGAG
AGGGATCGGGAGGGGAGCCGGCTAGTAGTAGATCCGGGAGGGAGTTCGCGCTTGCGAATGTGGTGGAGATTTTTATCTATCAGCCACAAAAGAA
page-top