Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1185
Contig Information
Length 742 bp
Tissue Shoot with ABA treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whva16m12    whva6l04    rwhva16m12    rwhva6l04    rwhva8h18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.48932e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1185
TTTTTTTTTTGAGGAATTACGTATGCATGCTCAAGAACCTATGTTCGTACATACATACACAAAATCATATAGAACAAAAGGTATGCTCCGGTCAGAAAGC
AGAGTCGTACAGCAGAGTTTTGGACAAAAGTGAAGTTCACAAAAGACCTTCATACGAGATAGGCCATTGTTTCAACTCGTAGTTTAGGCCTTGCCGGACT
CCTCGCAACCCGGTGGCCTAAAGGCGATGAAGCTGACGCACTGCACCTGGCGCAGGTTGTCGAAGCCGATGACACGGACATAGGCGTCAGGGTACTCCTT
CTTGACCTCCTCCACCTCGTTCAGCACCTGTGTGGCGTCAGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTATCGGCCGTCGTAGTACCCGGGG
GAGCTGTTGTGCTCACGGAAGACGAAGCCAACCTTGCTGAACTCGAGGCAGGGCACCCACTTTGAGCGGATCAGGTAGTCGACCTGTTTCAGGAGGGCCT
CCGTGGATAGGGGTGGCAGGTAAGACAGGGTCTCGAACTTCTTGATGCCCTCAATTGGCCACACCTGCATGCACCTGATCCTTCCGCCATTGCTGACGCT
GCTGAGGCTGCCGCTGGAGCGGCGGCCGACGGGGAGACCGGCTGTGGACTTGAGCCCCTGGAAGGGTGCGACGGTGGTAGCCGAGGAAGCCATCACGGCG
GGGGCCATGGTAATGTATTATCTGAGGAGAGGAGGATCCGCC
page-top