Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1183
Contig Information
Length 799 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva11f11    whva10f01    rwhva11f11    rwhva10f01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14097 [Oryza sativa Indica Group] >gi|125588421|gb|EAZ29085.1| hypothetical protein OsJ_012568 [Oryza sativa (japonica cultivar-group)]
Score 524
Evalue 1.72831e-51
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1183
TCGTCGCCTGTCCGCAGATCGGCGCTCGCTCGCTCTCCCCCTCCTAGTCCAATTTTCCTCTGCACGCGGGGTGGATACGTGCGTGGGTCCTCGATCTCGC
CGCTGGCAAACGCTTCGTCAGGAGCTGGGATCCATGATGACTGCAAGCTGAGGTTCGTGGAGCTCAAGTCCAAGAGGATGCACCGCTTCATAACCTACAG
GCTGGAGAACCAGAAGGAGGTCATTGTGGACCAAACTGGGGAGCGCGAGGCCACCTATGAGGACTTCACCAAGACCCTGCCTGAGAACGACTGCCGATTC
GCAGTGTTTGACTTCGACTTCACCACCCCGGAGGATGTGCCAAAGAGCAGGATCTTCTATATCTTCTGGTCTCCTGACACCGCAAAGGTGAGGAGCAAGA
TGACGTACGCGAGCACCAACGAGAAGTTCAAGAGGACCCTGGACGGCATCCAGATTGAGATGCAGGCCACTGACCCGAGCGAAATCAGCCTGGACGTGAT
CAAGGAGCGCGCGCACTAAGGCAAATCATCCCAATGCCTCGCAATATGGATTTATGTCAACTATAGATTTGGCGGTGTGACTCTTGAAACTTTCTTGATG
ATTTGTGGCTTTGTTACCGTGTCGAAAGGCCCTCCTCCCGTGGTCCGTGAGACCACGGAGGGCTTGCTCTATCATGTAATCTGTTCTTTTTCCTCTGCCC
ATTTATATGCCGGGCCTTATGCTGCTGCACTGCACTGTTCTTCGAAGTTACGGTTATAAATAATCAAATGTTCTGTTTGGATTCGTCACAAAAAAAAAA
page-top