Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig931
Contig Information
Length 884 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhcs10e21    rwhcs4d12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit H0820C10.3 [Oryza sativa (indica cultivar-group)] >gi|218194291|gb|EEC76718.1| hypothetical protein OsI_14737 [Oryza sativa Indica Group]
Score 672
Evalue 4.36839e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig931
ATATGATCCCACAATACATACCACTCAGCCATGCATGGTCTAGCTCTAGCTCTAGCTCTAGCTCTAGCTCTAGCTAGCTAGCACATCATCCAATCCAAGC
AAGGTTAAGCTAGGTTCAGGTTGGTTGGTTCAACAACGCCAACACCACAAACGGTAACATCCATGGGAACGTTCCCAGCGGCACCCGACACAACGGACCG
ACTTACGGGCACCCTGGATAACAGCTAAAGTTCCAGGTGCCATCTAGATAGTACATAGATAGATAGGTACTAGTAGGTTTTATTTATACAGACGCACGGT
TCAACCTCCACTGACAGAAAGCGGCATCGATCAAGTTCAAGAGCAGCATCAGATCAGCAGAAGAACATGGAGCTCCTCACTTTCTCGTGCAGCCGAGGCA
GCTCCGGCACCGGGGCGCTGCCCGCAGACGTGTGGCCCCCTCCCTGGCTCGACGACGTGTCCGACATGTCCTCAAACTTCATGAAGGTGCCCACCTGCGC
CGCCGCCAGATGCGCGTACGCTATCGGAGCAGCTACTGATATCGCCGTCGTGCTCCTCTGGTACACATAGGAGAGCGAGTGCACAAACTCCTGGAGCTCA
TCCCCACTGAAGCCGATCTCATCATGCAGAACATGGTAATGCGTTGGCCTCGACGTGCCAATCATCCCAGCATGCGCGCACATGTAGAAGTCAAAGTTCT
TGGGATGGCACACTTGTTTATCCACCACAGTGCCAGGAGGAACATTTTCTGGCGAGTTTGTCTGGAAAAACCTGGTATGATGGTTTTTCTGAGCAACAAT
GACCGTGAAACTTGGGCTCCCACTTGTCGTCAAGGCACTTGCATGCCTCAAATGATCTGCTCAAGCTCAATGTTTATCACCTGA
page-top