Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1154
Contig Information
Length 776 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva11g03    whva8i02    rwhva11g03    rwhva8i02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0816300 [Oryza sativa (japonica cultivar-group)] >gi|113550162|dbj|BAF13605.1| Os03g0816300 [Oryza sativa (japonica cultivar-group)]
Score 707
Evalue 9.79094e-73
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1154
AAGACAGAGTTGTCCACTGGTATAGAAAATGATGAAGCGTCTGAACAAGAGCAGACCTACCCAGAGAGTGCTTCAATTGCTCCTTCAGGTATGGATCACC
AGGGTGAGAATAATAACAAAGGGGCTGAAGAATCGATAAAAAACTATGGGAAGCATGTTTCTGATCCAGTAAACACAGGTTGCCAAACCAGTAAATTTGG
CCGACCAAGTATTGAAGAGGGCAGGAGAATACATAGTAGCAGTATATCTGTCTATCTGAAAGACATCACAGTATATCAGGAAAGAATTCGTTCTGATCCA
TCAAAGAGTACACATATAAACAATGCTGGGTATTATTCTCGACATGGAGCTCTGGAACCAGTTTCAGTCAGCAAGGATATCAAAGTTCCATTGCATGATA
CTGGGAGGGTTTGTGGAAGAGATCGTGCACTGGAGTTGGTGACAGGTCCACCAGAAGAGACGCCTCGATGGAGACAAGAGCAATATGCACTTAATATTTT
AGAAGATGTGCAAAATGCTCGCAGTGCTGAGAAAACTAGGATGGAGATGGAGATCAGAATACTGAAGGCACAGATTGCTAGCATGCAGAGACAAGTGATG
AACATGGATCATGTTGGTGAGGTTATTTCCAGATCAAAAAGGCATTGACCTTTTAATTAGCTCCATGATAAATGATAGGTTAGCATAAAATTTCATGTAG
AACTGTACTTCCTTTGTGAGATCAAAGACCAATGCACGCTAGTTTGTTTCGTTTGTGTTGACTCTCCATGAAGGTC
page-top