Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1132
Contig Information
Length 742 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva11e08    whva11e19    rwhva11e08    rwhva11e19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cold-responsive LEA/RAB-related COR protein [Triticum aestivum]
Score 553
Evalue 6.52039e-55
Total Hit Count 60
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1132
TTTTTTTTTTATGATTGGTGGAAAATATATTCATACCTCGGTCGGATACATCATACAAAGTTACACCAAGGAGCATGTGTAATTAGTGCCATGAAACTGG
AAATTAAATTATATTGAGGGAATAGCGAAACAGAAGGAGGGCTAGGGCAAGCAGGCGCAGACACGCCTATTATCCTTTGTGGTCTTCTTGGTGGCACCAC
CCGCATCTCACTTGTCTCCTCCCATCCCGAGCGTGTTCATGACAGCGTCCTTGGCGTCAGTAGCAGCACCCACCATATTCCCGCCGGCCTGTTGGAAGAC
GTTTTCCTTGGGGGCGACCGGGGTATCCTTGGTGTACTGTGCAGCGGTGTCCTGGACATGCTGTGCGGCCTCGGTGGACTTCTCCTTGGCAGCATCGGCA
GTCTCGGTGGCCGTCTTCTTGACAGCGTCAGTCTTGTCGCCGAAAAAGCTGCCCGTCTGGTCTTTGCCCTCGACGGCGTGATCCTTACCGGCTTCCACCG
TCTCGGACACCTTCCCCATGGCCTCGTCGCCCATCTTTTTAGCCGCCTCGGTAGTCTCGGAGGCAGCCTTCGTGACAGCCTCGCTTTTCTCACCAAGGAA
GGCCCCGGTCTGGTCTTTTGCCTCAACGGCGCGGTCTTGAATGGACTGCCCCGTCTCGGACGCCGTCTTGGTGGCGTCGCCGGACTTCTCTTGAAACCAA
CCAGACATTTTTGAAGTTGATGGAGTGTTGGTACGTACTAAT
page-top