Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1114
Contig Information
Length 814 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva11f20    whva19g01    rwhva19g01    rwhva11f20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=V-type proton ATPase 16 kDa proteolipid subunit; Short=V-ATPase 16 kDa proteolipid subunit; AltName: Full=Vacuolar proton pump 16 kDa proteolipid subunit >gi|166549|gb|AAA32712.1| H+-ATPase >gi|108925912|gb|ABG23316.1| vacuolar ATPase subunit c [Triticum aestivum]
Score 583
Evalue 2.53364e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1114
GCGACGAGGCCACCCAGAGCTCCACAGGAAAGAAGCGCGACCGGAGAAAGAAGGAGAGCAAGATGTCGTCGGTGTTCAGCGGCGATGAGACGGCGCCCTT
CTTCGGCTTCCTCGGCGCCGCCGCCGCCCTCGTCTTCTCATGCATGGGGGCGGCCTACGGGACGGCCAAGAGCGGCGTCGGGGTGGCGTCCATGGGAGTC
ATGCGGCCGGAGCTTGTCATGAAGTCCATCGTGCCCGTCGTCATGGCGGGAGTGCTCGGAATCTACGGCCTCATCATCGCCGTCATCATCAGCACCGGGA
TCAACCCCAAGGCCAAGCCCTACTTCCTCTTCGACGGCTACGCTCACCTCTCCTCCGGGCTCGCCTGTGGCCTCGCGGGGCTCGCCGCCGGCATGGCCAT
TGGCATTGTCGGTGATGCTGGAGTCAGGGCTAATGCGCAACAACCAAAGCTGTTCGTGGGCATGATCCTTATCCTCATTTTCGCAGAAGCACTTGCCCTT
TATGGTCTCATCGTGGGCATCATCCTCTCGTCCCGTGCCGGCCAGTCCCGTGCGGATTAGGCGCCTCGCTCTACCATTCTGCAATTGCCACACAGGCTAC
ATTCTTGAGAAGCTGAAGCATTGAAAAGTTCTAATTTTGATGTATTAAGGAGATATTTGTAGATTTTTAAGGAAGGTGACACTTCCAGTACCGTTTTCAT
TCTTTTTGGGTTGTGGTGGGCGTTTGCTGTTCGTGCAGAGGATTTTGGGGTAGGCTGGATTGCTGCTCCTGGGAATATGGGTTTTAATCCTACTGGTGGG
AAAAAAACACGCAT
page-top