Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1107
Contig Information
Length 1274 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva15b09    whva10c11    rwhva15b09    rwhva1g08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0136400 [Oryza sativa (japonica cultivar-group)] >gi|113644393|dbj|BAF27534.1| Os11g0136400 [Oryza sativa (japonica cultivar-group)]
Score 431
Evalue 6.13608e-80
Total Hit Count 322
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1107
TTGTTGTCTGGATGTTGGGGCCAATTAAGGCTTATGCTACAGAAGTATGCCGGAAAGAATATAGTCACTTGGCATTATCACTTATTTCTTCCTCACGTGC
CATAGGCCTCATTGTTGGTCCAGCCATTGGTGGTTATCTTGCACAGCCAGCAGATAAATATCCAGGCATGTTCTCTCAGGAATATATATTCGGGAGGTTT
CCATATTTTCTCCCATGCCTGTGTATATCAATCCTCGCCGTTGCTGCTTTAATTTCTTGCATCTGGCTTCCAGAAACTTTACATAAACACAATGAAGCGA
CATATTCAAATAATTCGATTGAAGCCATGGAAGAATCTCTTTCCGGCTCTAATGCTGAAGAAAGTAGTGGTGGATATTGGAGTTTGTTCACAAACTGGCC
ATTGATGTCTGCTATCACCGTATATTGTCTTTTCTCGCTTCAGGATGTGGCTTATGCAGAGGTATTCTCTCTTTGGGCCTGTTAGTGACAGGAAATATGG
TGGATTAAACTTTACTTCTACAGATGTGGGCAGTGTCCTAGCACTCTCAGGTCTCTTCCTCGTAATATACCAGATTTTGATTTATCCATCGGTTGCAAAA
GCTATAGAACCTATCACATTAGTCCGTGCAACTGCGATCTTGACATTACCACTTCTTGCAAGCTATCCATTCATGACTACATTATCAGGGTTCAATCTTC
AGTTGGTAGTAAATTGTGCATCTTCTCTGAAGAATTCCTTCCAAGTAACTACCATCACGGTGTGCAATATTTTGATGAATGATGCTGTGAGTCAAGACCT
AAGAGCATCGGCCAATGGACTTTCTGTAACACTAATGTCCATCTTCAAAGCTGTCGCTCCGGCTGTTGCAGGTGTTATATTTTCATGGGCTCAAAGGCGC
CAAACTGCTTCATTTCTTCCAGGCGACCACCTTGTGTTTTTCATGCTTAACGCGGCCACCGTCATCGGTCTTATGTGCACCTTCGGACCACACTTTGCTA
GGGGCAGCACGAAGCATTGATGTAGTAATATTGTTGCGACCTGGGAAAGAACAAGGAACTATTGTTCTGTCTTGTGACCTTCTTCCCCTTGAGCATAGTT
TTGTGCTCCACGCCACATGTTATTATTATTATTTGTAGTACAGCGGCATATAGTGTTGTTAGAAACATATATATGCCCAAGAGGCAATCATAGATGTAAA
CAATATTCCTTTGTATTTATGGTTTATTCGCTCTTCTTGAATAAACTCATGTGTATTTATCAGCAAAAAAAAAA
page-top