Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1103
Contig Information
Length 967 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva15c21    whva18f19    rwhva15c21    rwhva18f19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 1147
Evalue 1.3579e-123
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1103
GCCCCCTCCGATCGAAGCGAAGTCAAGGCTCTTTCGTCCTCCTCCTCAAGATGCAGATCTTTGTGAAGACCCTCACCGGCAAGACCATCACCCTCGAGGT
TGAGTCCTCGGACACCATCGACAACGTCAAGGCTAAGATCCAGGACAAGGAGGGCATCCCTCCGGATCAGCAGCGTCTCATCTTCGCTGGCAAGCAGCTC
GAGGATGGCCGCACCCTGGCTGACTACAACATCCAGAAGGAATCCACACTCCACCTGGTGCTCAGACTCCGTGGTGGCATGCAGATCTTCGTCAAGACCC
TGACCGGCAAGACCATCACCCTGGAGGTTGAGTCCTCTGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCA
GCGTCTCATTTTTGCTGGCAAGCAGCTCGAGGATGGCCGCACGCTCGCTGACTACAACATCCAGAAGGAATCCACACTCCACCTGGTGCTCAGGCTCCGT
GGTGGCATGCAGATCTTCGTCAAGACCCTGACCGGCAAGACCATCACCCTGGAGGTCGAGTCCTCTGACACCATCGACAACGTCAAGGCCAAGATCCAGG
ACAAGGAGGGCATCCCACCGGACCAGCAGCGTCTCATCTTTGCTGGCAAGCAGCTTGAGGATGGCCGCACTTTGGCGGACTACAACATCCAGAAGGAGTC
CACACTTCACTTGGTGCTCCGTCTGCGCGGTGGCCAGTAAGCTCCTGGCCATGGATCTGCTTCTGTCTCTGGGTTCACAAGTCTCGTTGTCCTCGGTGTC
CTCCAATGGAGTCTGGTCTGTGTCCGTTGATGCCTGAACTGTCTTTGTTTGTATACCATATACTGTGATGCAGTGTTATCGTTTGTATCTGCAAACTTCT
GCTGGTGTGCGGAAGCTTTGATGAACTTAAGAATAAGTGAGCCCTGGAGTCGGTCCATAATTCTGTT
page-top