Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1082
Contig Information
Length 624 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva15e17    whva15f05    rwhva15e17    rwhva15f05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0499400 [Oryza sativa (japonica cultivar-group)] >gi|113631804|dbj|BAF25485.1| Os09g0499400 [Oryza sativa (japonica cultivar-group)]
Score 108
Evalue 1.42171e-06
Total Hit Count 108
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1082
CCTCGTGCCGTTGATTTCTGCCATGTTTATGGAGGGAGAGGACGCCAAGTACTAGGAGAAGGATCAGTTTAGCAAGTACAGGCTGTAATTATCTCGTGAT
TATGGATTGCTGAGAAGCGCAACCTTTTGATCTTCGAGAACCGCAAGTTTGCTGACATTGAAAACACATTCATTATGCAAGACGAATGGCTCTAGAATCA
CTAAGGTTGCTCCTTCTCTGTTCCTTTGCTCCTTCCGCCGTGAGGTGCAGGTGCCGCTCCGCAAGGTGCTCGAGCTCCCGAGGTCTACATGAGCGCCTGC
AAGTGGGACGAGCTGCCCTACGCGCGCGTGGCGTCCACGGCCATGCGCCAGTACAAGGAGGCGTCCTGGATGCAAGATTTTAAATAGCGTCCGCTACCTC
CGCTATTGCGGCTGCAATAGCGGTAGCGTCACCCTGCCGCTATTAGTTTAAGGTTGCGTTAGAAAATAGCGTGTTGTCATGATGCGGGCGCAATATCACT
TGTTCGACCGCTATATCATCCGCTATCCGCAATATCACCCGCTATATACGTCCTTATTGTTCTATTGTGTAATCTATTTTAGTAAATGTGTCTTGCTTGC
ATGGTTGCACGACCAAAAAAAAAA
page-top