Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1081
Contig Information
Length 746 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva15e18    whva3a18    rwhva15e18    rwhva3a18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit senescence-associated protein DIN1 [Zea mays]
Score 429
Evalue 1.55187e-40
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1081
CCTCACACAGAAACAGAGGCCCCTTCTTCCTAGCTGCTCAATCCTCCATAGATGGGTTCCCTGCGGAGCAGCACAAGCACGGCGGTGGAGAGCGTGGACG
CAGAGGCGGCGTGCGGGCTGCTGGCCTTGGAGCAGTACGGGTACGTGGACGTGCGGATGTGGGAGGACTTCGAAAAGGGCCATGTTGCCGGTGCACGCAA
CGTGCCCTACTACCACTCAGTCACGCCCCATGGCAAGGAGCGCAACCCGGACTTCGTCGACCAGGTTGCTGCGCTCCACTCAAAGGAGGACCGGTTCCTT
GTTGGCTGCCGCTCTGGGGTCCGGTCCAGGCTCGCCACCGCAGACCTCGTCGCTGCTGGGTTCATGAACGTGAAGAACCTGGAAGGTGGTTACCTCTCCT
TGCTCAAGAGTACCAGTTACCCACAGCCCCAAGCAGCCAGCCACCAATGATCCATCAATTGATTCTTGTGAGAGTTTCGAAAAAGTTCGTTAGTGACCTG
TTTGTGTACTGTGTTTCTATCACCCTTCGTCTTCTTCTTCTGAAGAAGAAGAAGAAGAAGAAGAAGCAAGTCCTTCAGCTGAGGCGGACATCTGGGATTT
AATTACTATCAAAGGGAAAACAAAGCCGTATGTATGTAGGTACGTATATTGGACATGGACTTTGGACCAACCAATTCCCAAGAAATAAAAATGTTTGCGT
GTACAGCTGAGTACCTGTTTGACAGTTTCACCGACTCAGCTCAATA
page-top