Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1077
Contig Information
Length 834 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva6e19    rwhva15f17    rwhva6e19    rwhva6e20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0589800 [Oryza sativa (japonica cultivar-group)] >gi|113532977|dbj|BAF05360.1| Os01g0589800 [Oryza sativa (japonica cultivar-group)]
Score 357
Evalue 6.04347e-44
Total Hit Count 263
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1077
AAGAAAGCTGGAAATTGGATTTTACATTCGTCAAAACTGACAGGACAGCACAAATGAAACTCAAGGATATAATAGTGTGCAGGATTGATCTTTCTATACA
TGAAAGAAGATAGATTATACTTCAGACTTATAGAAATACAGAACAACACCGCCAAACATGAGCCATCAATCCAAATCCACAATCCCAAAATTGGAGAGAA
GGATCTTCATTTGCTCAACGAAATCCGAGCCTGTTGCGTACTCTGTTAGCATCCCCACTGCAAACCCAAACATAGCCCATCTTCCATTGGCAATCTCATT
CTTGGCCAACCACCCAAAGAAGGGTCCCTGGTTGGTCTCCTCCAGCTTCTTCTTCTTGAAGTATTCCTGTAGCTCCTTGGCCACCTTCCTCTGGTACTCG
AACGTCACAACCCCTCCCACCGGTGGCGTCGCAGCGGCAGCCACTGCCGGTTTGGTCTCGGGAGGAGGAGGTGATGGCTGTGCTGGCTTCACTGGGGTCG
GTGGCTGGGACAGGCTCGGAGGGGTGGACAGGGCTGGCGTCTTGGGAGGCATAGGCGGGGGCGGCGACAGTGGAGGCGCCGTGGGTCTCCTGGGCCCCTC
GGCCTTGGAGCTCCTGATCACGGCGAACGACTTGCATGCCCGGTACGGAGGCGGCGGGGCGATGCGTCCCACCTTCACCTTGATGGAAGGGATGGAAGGT
GCCAAAGACATTGCTTGGTTTGAGCTGCCTGGCGCCTCGTGCCGAATTCNGCACGAAGGCCANAAATGGTTCNAAATTACANGCTGCTCNACNAAATGAN
GCTGNGGGTGGNCNNCCTAATGGCTGTTTGTTTG
page-top