Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1055
Contig Information
Length 1287 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva15e02    whva5d07    rwhva15e02    rwhva5d07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18577 [Oryza sativa Indica Group]
Score 1793
Evalue 0
Total Hit Count 311
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1055
CATGCCACCAAGCAAAATGTTTGAACTGTTATCCATGATGCACTTTTTACAGCACCGTGTTTGAAGGAGGCTTACAACACAAAGTATTACTAGTCTTGAG
AGACGGAGAACAACATACAACATGTCACGTCAAAGTTTACAGATCACAGAGATCTCCATCCAAAACTGAGCGGATCTCATTGCAGGTTTCGATATGCTAG
CATAGGGGCGAAGGGGCGTGCTACGGTGGCTACGACTACGAGAAGGTGTCCTCCCTGTCCCCCTCAGCGACCTCGCCCTCCTCAATGTTGCTGAACTCCA
GGAAGTGCGTCGGCCTGTGGTCCTCATGGTAGAAGTCGCGGGGTGTGCCCAGCTTCATGCTGTACTTCATCAGCGGGTCGTGCTTGACTCCCATGAAGTT
GTAGTTCCACGGAGCGTTGTCCGGAACCATGTAGAATCCAAGGAAGCGGTCGCTGAGAAGCATCTGGACCTTCTCGTAGTGAGTTGGGAGGTACCCTTGT
GGGTTGCTCCCGTTGTCCTTGTTGCCACGGGCCCACTCATAACCACTTGGTGTCAATTTGTACGCAGTCAACGAGCACGATCCTGGGGTGAAGCTGCAGG
TCAAAATGATGCACTTCTCACCATCCCACTGCTTGTTGTTCTCCAAAATTTTAGCATGTGATGTCAAATCCTGAGGTGATAGCTGAGGAGCTTCATTCGG
CTGGGTATGCATCCATCCCAACGGCTCCAAGTCAGCAAGGAACTCATGCTCTGGGAGATTCGATGGCAAAGTCACCATCTGGTGAGTTCCATGCTGTGGC
GGAATGGATATGCATCTGATCTCCTTGACTTGGGGATTATCCTGTGGACTCAGCCCATACAGGAAACCTGCAACCTGTGTCCGTAGATCTGCTATGCATA
TGAACTTCTTCAATATATTCTTTGGCATGATGTAAGTATAGCCAGTCTCCTTTATATCATCCGAGTTAACATAAATGTGGTTGACACGGAGATACAGGTT
TGTAGCAGAGATGGCCCTGACACGCCAATCTGTCTTCGATGCAAATGCTGCTTGCTCATACGGACTGGTCGTCGTGACGATGAGCTCATCTCCATGCACA
TTAACTGTCCTCGTTGTCTGTGCAGTTACCTGATTTGTCTCTCGGGACTGTTTCTCAATCTCAGCTATCTGTTGCCTCTGCTGTGACGGTGGAGCTATTT
CAGCACCAAGTATTATATCACGAATCTCAGATTGCGTAAGTGCAGAAGTATTAACGTTGTTTTTCTTTGCATAATCGGAAAGAATCG
page-top