Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1052
Contig Information
Length 1077 bp
Tissue Shoot with ABA treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whva15f23    rwhva15f23    rwhva15f24    rwhva7l14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Chlamydomonas reinhardtii] >gi|158275807|gb|EDP01582.1| predicted protein [Chlamydomonas reinhardtii]
Score 94
Evalue 0.205073
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1052
TTAGGATGAACTGAGGTCAACCACATACATTTTTCTATAGCCGAGGGCTTAGATTGTAAACTACGATAACCATAGGGTTAAATTGTTGAAAAGAGTAAGT
TCGAGTACTAAACAGCAAAGTCCATTGGCCTAATGGCCCGGTTCTAAAATGCAGCAAGCCAGAGGGCTAAACGGCAGAGACCTGTTAAACTGTGGTTTAC
ACAGATATTTTAAGGGACTTATACTAGATTAGGCTCGAATCTAAGGGCTGAATTGAAAATCCACCAAAGAGATAAGAAATCCCCAATTTCTTCTCCCGTG
TGTGCTTCCTGGCCACTGGTAACTGCCGCCGCTCAGTGCGAACCGGCCGGTAGTTGCGCCACCGCCGCTGCTTGGGAAGCGAGGCCGTGTCGCACAGCGC
CTGAGGGCACCGCCATGCGCAGGAAACTGTGCCGCACCGGAGTACGTTGGCCGCCCACTCGCGTCGAGCGCCGATGATCTTCGGGTGCGGTTGCAGCGCC
TTAGGTGGTCGCTCGGACGAGCGCTGGAGGATGCCGCTGGGAAGGCCGGGGGCCTCTAGCCCCAGGTGCCCTCGTGCCAGGGGAAGCAGCGTCGGGCCGG
CGTTGAGAACTTCGGCGTGGAGGTTAGTGCGTCTTGTGTGCAAGAGCAAAAAGAATGGAATATGGTCACCTGATGATGTAGCAATTAAGATCGAGAGTTT
GGTGTTTGTATAAATTAATGCTTCATCGTCTTGGAGAAGGGGCGGCCCAGATCCTCGTTATTTTTCATGTGATCCCCTTTTCTCTTCTTCTGTTCTTGGC
CGAACTTGGTGTTTCGTCTGTGAGGACGATTTTTCTCCTCAATCCTCTGTCTTCTTTTTGGCAGTTATTGGTATGGATTTTCGATCGAGTGATCCTGGAT
GCCAACGCCCATATCCTTTTCTGTGCGTCTTCCTTGTGTAATTGAAAATTGTGCCCAATTTCAAGTTCTGATGTTCCTGCTTGGAGTATGATAAATCCGC
TCAATTGATTGATTTTCTGTCCTTTGGCAGAGTGTGTTCGAGGCTTCCAATTCTGAATCGATGGAGGCGGCGCTGCG
page-top