Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig919
Contig Information
Length 844 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhcs10d11    rwhcs17o05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_011386 [Oryza sativa (japonica cultivar-group)]
Score 1177
Evalue 3.62285e-127
Total Hit Count 179
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig919
GAGGAGGAGGGTCTTGACTCTTGACACAAGACAAAAGCGACCGAGCGCCGGCACACAAAGAACAGTTTGTGAACTAACTACAAACTACTAGACGAAGGAC
CAGTTGACGAACATGAAGGCGAGGCAGTGCGGCGCGTCGTCGTCGCCCAGCACCTTCCACGCCACCGCCTGCTCGTACGACACCGGCCGCCCCATGCTCG
ACACGCACACGCCGCCCGGGAGGTACGCGAAACCCTGCTGCATGATCTTGGGGAACTCGGAGCAGAGCGCCTTGCGGCCGTCGTCGTCAAGGATCTTCTC
GAGCGAGATGTCCTGGAGCGCGATCAGCGTCGTCTCCAGCATGTCCAGCCCGGCCTGGTTGGCGAAGGTGAACACAGGAGCAGCCTTCAGGGAACAGCAC
ATGATTGAATCCGAGTGCTGCCACAGCGCCTTCAGGGAAGCGTCCGCGCTCTGCGACTCCGTGCAAAGCAGTTCCGCCCCGGTGTGAAACCTGTAGCTCC
TGCCGATCCACCTCGCAAGCGTGTGAGCCTCAGGGGATCCTGGAGGGTTCTTCATTTCAAGCTGTCCACCAGGACGGGAAGGGGCAATTGCCATGGCCAC
CCTCTGCACCGATGCCACCACGGTCCTCACATACTGCCTCGCCATTGCTGCAACACTCTCTCGAAGGTGGTTCTCATACGAGAACTGGAAAGCAATGGTA
AGCACTGATCTTGTGTTGCTGGTGCTGGATGCGTCGCTGGGTGCACGAGTCCCACCAGGTCCAACCTCNAGAGTGGATGCAAGGTCTAGTGTGCGTGTTG
CCGACGGTGCATCCGTCTTGGCATCAAGTGGTATCACACGGGAA
page-top