Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1007
Contig Information
Length 647 bp
Tissue Shoot with ABA treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whva15c18    rwhva15c18    rwhva4i09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0823600 [Oryza sativa (japonica cultivar-group)] >gi|21104591|dbj|BAB93184.1| unknown protein [Oryza sativa Japonica Group] >gi|113534192|dbj|BAF06575.1| Os01g0823600 [Oryza sativa (japonica cultivar-group)] >gi|125528208|gb|EAY76322.1| hypothetical protein OsI_04255 [Oryza sativa Indica Group] >gi|125572471|gb|EAZ13986.1| hypothetical protein OsJ_003811 [Oryza sativa (japonica cultivar-group)]
Score 514
Evalue 1.62434e-50
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1007
TTTTTTTTTTACTGTCCTAATCCCTTGATGTTATAGCATCCATCTATTTATCTAACCATGAGTGGGTCTGATGGTACAAAAGAAGTTCATCTGCCGAAGA
GTTTGGAAAAGAAGTTTGTTGGTTTCGAGTTCTCTGCGCACGCCACATGCATATATCTTCCTAGATTGTCAACTTGCCTTGGCTCCCCTCTTGTGTCTTT
CTTGCAAACTTTGCAGGTCTTGTCCACCCAACCTTCCTCCACGTATTCGCCGTCAACTTCAACATATGACTTGAAGAAATCCTTGTAGGTGCCACCAATC
TTCCTCCGAAGGGCTGCATACTGTTCCCTTGTCATCCTTCCTTCATCTTTGATGGAATCCCTGGCCTCATACAGCAGCTCCGCGTCCTTCTCCGACCGGA
CCTGCGAGAAGTCCAGCGCCTCGGTGATGTTCCCAAACAAGGACTGCTTGGGCACCTTCTTCTTCTCCTCCTCCTGCTCATCTGCTTTCGCATAGGCCCT
AACTGATCTAGCAGGACTGGCGCTGCCTGGCTTGAAGGAGGGCATGCTCTGGTGGAGCCCAAACGAGGAGCTCTGGGCCGGGGACAGCGCGAGCGCCCTC
ATGGCCATGGCTTTGATCAGCTGGTAGTTGGTTCTCCTTCACCGCAG
page-top