Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig995
Contig Information
Length 912 bp
Tissue Shoot with ABA treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whva11c15    rwhva14l10    rwhva8k18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|396134|emb|CAA80666.1| protein synthesis elongation factor-1 alpha [Hordeum vulgare subsp. vulgare]
Score 1115
Evalue 6.36686e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig995
AACGACTCCAACATGCCAACTATATATAGTAGCAACATTAACTGACGAAGTTTCACCAACACAACCGAACGATACAATGACAGAGCAATAAGCAGTTCCA
ACACTGCTCGACACAAATAACCGAAGCTTAACAAGTTTCCAAAACAACTAGAACAACTATCACCACCACCAAATACCGCCACCGCCACCATAGATGCAGT
AAAGAACCTGACACCATCTCATTTCTTCTTGGCCGCAGCCTTGGTCACCTTGGCGCCGGTCGGATCCTTCTTCTCCACGGCCTTGATAACGCCCACGGCA
ACCGTCTGCCTCATGTCACGCACAGCAAAGCGGCCCAGGGGAGGGTACTGGGCGAAGGTCTCCACCACCATGGGCTTGGTGGGGATCATCTTGACGAACC
CGGCATCACCGTTCTTGAGGAACTTGGGCGCCGCCTCAATCTCCTTGCCAGACCGCCGGTCGATCTTGGTCTGGATCTCAGCAAACTTGACAGCGATGTG
GGACGTGTGGCAGTCCAGCACCGGGGCATAGCCGTTGCTGATCTGGCCGGGGTGGTTCATGATGATGACCTGGGCGGTGAAGTTGGCAGCCTCCTTGGCA
GGGTCGTCCTTGGAGTTGGAAGCGACGTACCCACGCTTGAGATCCTTGACAGCCACATTCTTGACGTTGAAGCCGACATTGTCACCAGGAAGCGCCTCCA
GGAGAGACTCATGGTGCATCTCCACAGACTTCACCTCAGTGGTCAGGCCAGTAGGACCAAAGGTGACAACCATGCCTGGCTTGATGACTCCAGTCTCAAC
ACGCCCCACTGGCACAGTTCCAATGCCGCCAATCTTGTACACGTCCTGAAGGGGAAGACGCAGGGGCTTGTCGGAGGGCCTCTTGGGCTCATTGATCTGG
TCAAGCGCCTCA
page-top