Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig913
Contig Information
Length 870 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhcs10c08    rwhcs13n09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_22102 [Oryza sativa Indica Group]
Score 1049
Evalue 2.62729e-112
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig913
GGGTTTTTTTTCTTTTCTATTGATGTCAAAATCTGGGATACAACTAATGAAACAAAAATAACATATGTTTTATTGAGAAAACAACGACACTTGTTACAAC
AAAGGCTATATGAGGGACAGGTTACAAATATACATCCAGCTCAAGCCGCCAGTTTGGCCAAAATCACCATATCTAAGATCTTGACCTCATAGGTGTCGTC
GAGCTTCACAATGCCATCAGAACCGTCTATTCCTATAAGTTTTCCAACAAATCCGCGGAAGGTACCATTCATGATCTTGATCCTGTCACTCTTCTTTGGT
CTGATGACCTCGAGCTCAGTCGGAAGGACCGTCACAATGTCTCCGTTGCCTGACGACCCAAGTGCCACACGGCAAGTTCCATCCCCAAGCACTTCCCTGA
CCACACCAGGTCCTTCATCACCTGCCGCCAAGACATTAACTAACACATCTGGCAATGCCCAGTTAACTTCGCCCTCGCCACCTATTACAGGAGACATTAT
ATCCATTCCAGCATTGCCTGGAGTCATTGGTTGACCACCAGGTGTACCAGGAAGGTACGCAGCAGAATTTGGTGTCATTGGCTGGCCAACAGGTGTGGAA
GGCACATATGGGCTTGGAGCATTCGCATAGTTGCCCTCTCTAGGAGTTGGGACGTCATTATAACTAACTCCTGGAGTATTTGCCCACCCTGATCCAGGTG
TTGGGGCTTCATATGGCCGAGCTGGTGGTGTTCCTGGCTGGTAAGCTGGACTGCTTCCCCAAGTATCAGGATTTCCATCTTCCCAATTATCTCTTGGAGG
ACTCATAGGAGCCCAGGCCCTACTACGCATCGGGGGTTCGCATTCCATCATGGTATCGGTGTTGCTCCAG
page-top