Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig940
Contig Information
Length 808 bp
Tissue Shoot with ABA treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whva15a04    rwhva15a04    rwhva15a15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative helicase [Oryza sativa (japonica cultivar-group)] >gi|31432486|gb|AAP54108.1| AT hook motif-containing protein, putative [Oryza sativa (japonica cultivar-group)]
Score 119
Evalue 1.36223e-06
Total Hit Count 96
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig940
ACATATGCCTATTTTGCGCAAGAAGACTTAAAGCTCAGGTTGACACATCTGCAACATAGAAACATTACAAGACATCACACCTAGCGAATCAACACATGCC
GCCACACGTCACAACACTGTTACGACATATTGAAGGCAGATCCACACAACACATCCACACATGCCAAGGACGGTCAGTTGCACCGGCAAGGTCGATGCTA
AGGTCGATCAGTTGCAACGGCAAGGTGGATGCTGAGGACGATTAGCTGCACCTGCAAGGTTGCTGCCTCGCCTATCAAAGGGGATGGTAGGACACCCATC
ACATTGAAGGCCCGAGGAAGGAACAACAGAAACAACATCAACTTTGGGTAAGAACACTTCAAGTTCTTCAACACATGCTAAGGACGATCGATTGCACCAA
CAAGATCGGCATGACACCCCGCGTATCCAAGGGGGCGGCAAGACGCCTAGACACATCGAAGGCCTAAGCCTGGACCCAGTGTGGAAGGCAACATGCAGCC
TACGGAGTTCCTCAACACCTTGACATCCCTAGGAATCCCTGACCATAAGTTAAAACTGAAGGTGGGTTTGCCAATCATGCTCCTCAAATCATCATGTTAC
CCAGCAACGCAAAATGACCATTCGTGCTTTTTCCTCTAGCAATGGATATCAACTCTATTTAATCTATCCTCATCTCTCTCATACCACATACTTCCAGAAG
ATGTCGATCTCCAGCTCAAATCAATCTAATGAATAGTCCCCATATCCCAATATCTATAATATCAGCTCCATGAAAAAGTGCCTGTGCAAGCTACCCCAAA
TCCATTCG
page-top