Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig916
Contig Information
Length 1080 bp
Tissue Shoot with ABA treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whva12n21    rwhva15d10    rwhva3p17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative tyrosine phosphatase [Oryza sativa]
Score 425
Evalue 8.51657e-40
Total Hit Count 111
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig916
CAGCTTTGTGAAACATAGAAGAAAATTACAAGTTTTGTGCTATCCAAGTGTTGATCAGATCAGCCTTATCTTGCTTTGCTCTGATTCTAGTTACTTCAAG
CCACTGTTTGAGATAATATTTCCATGAATCGGTTAACCAAAGTTGCAGGGGGGCTTGGAAATTGATCATAATAAAGCTCTCGTGATGAAGAATCTGCATA
AATTCTTCAATAGAGATGACCTGCCCTGGTTTAACCTTATTTGGTAAGTGCATTACTCCTCTTCTCTCCCACAAGACAAGGTGGGCTCCTTTAGGTTGAA
GACCCACCTCAACCTACTCCAGACTTACAAACAGTCATGTCTGTGCATTGCAAATTCTGAGAGCACCATCCAGTTCTGGAGCGATAAATGGAGTGAGGAA
CCACTTCAACAAAGACTCCCAACTTAGAAGGTAAAACGTGTTTTGTCCGTCAAAAGCTGGCTCTTGTGTTCACCAGAAAATATATCCACATCCCGATTGG
TACTTCAAGCACGATAGCTAGTACGTCACAACTTACAAGCACGATGGTAACATATTTCCTGTAGCCTTTGCTTTCCGAATGGAGGATTGCCATTGTTATG
TACAAAGTGTATGTTCATAGAATGGTTGAAGTACAAAGGAAGGCTAAAAACATTCCTGGAGATATCTCCCAAGGTTAAAAGCAGGGGGGGGAGGCTGGGC
GGTATGGCCAAGTGTGCAAAAGACCAAGTAGATGTGTGCAATCGATAGGAGGTCATCACTTCTTACCGAATCCAAATATGGATTTGATAGCATTGATGGC
GTTCTCGTTGATAAATGATTCATCGTACTTGTTTAGTAGGGTGGCGAACTCCTCCGAGTTCCTCAAGTTTGCTAAATCCGGGTCGGTGCGAATCCTCTTG
AAGTCTTCATAGCCTGCCTTCATCGCTTCTTCAAGTGCAGAAAGGCCAGCTTGTATCCGGTCGAGCTTNGAATAACAGCAGGCGACATTGTAGCTGGCTA
CGGAAGCTTCATCAATCTCTGGTTTTGACCCCAGCACCGAGCTCGAACTTCTCCAACGCGTGCCTCGTATTTTCCATCCT
page-top