Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig862
Contig Information
Length 747 bp
Tissue Shoot with ABA treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whva11e06    rwhva11e06    rwhva11e18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_16082 [Oryza sativa Indica Group]
Score 893
Evalue 2.45871e-94
Total Hit Count 450
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig862
TTTTTTTTTTATACTGTCATCTATAGAGGGGCATGCTATATTCACAACTCACAAGCTTTTCAGATCTTACAAGAATAAATGATGCTTCCGCAACAATCAA
TTCCACCTTCATGTGATCCTATAATGACATTATTACATGGTGTCTGCATAACTGCGCACAGCATTCGCCAAATCCTGAACATGCTGATCCACAATACCTA
TTTTGTTTAACGCGTCCTCAAGTTTGAACAGATACTCTTTATTAGGTCCAGTTGGGCCTTCAGCTAGGTAGATTTGCTTGGCCATTTCTTCTAGCGGAGC
GGGACCCAGATAGTTTCGGTTGGCTTCCTTATTTGTGGTGGCTAAATATATCATCATATCTTGGACTGCTGGTATTTTGAGGGAAGAGTCTGTATACAAG
TCAAGGTAAACCTTCTCATCATATTGCTTCTCTCTTACTTCCAGATACTCCAGGGCTGTCTGCTTATCTTGCTCCCTTGAAATTTTGTAAGCAACTCCCC
AGCATGTGGACCCGGGCTGGTGTTCCAGCGTGACGGTCCTGCCGGGGAACTCCGGCGTGCCCCTGTGGTCCGTGCTCCCCTGGTAGAAGACGCGGCGGTA
GTCCCTGACGAAGCCGACGAGGCGGGCGTCGTAGGCGAACCCGGGGTTCCACACCAGGGAGCCGTAGCCGAACACCCACATCACCATGCCTGCCCCTCCC
CTCACTTGCTCCCAATCGGCGTGCGTGTGGGTTTGCCTCTGCCGCTT
page-top