Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig856
Contig Information
Length 1107 bp
Tissue Shoot with ABA treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whva11d17    rwhva11d17    rwhva7n20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit shikimate kinase family protein [Zea mays]
Score 537
Evalue 9.98933e-102
Total Hit Count 90
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig856
GTGCCCCTCTTCTACTTTCTTACTCATTCGAAAAAATCTCCTGCTTAATGTTCGGCCGTGGAGCCATATACATTTTACAACCGGCCACATGAATAACTTG
CAGCGAGGAGTACCGTGTTACTATAATGTCGTGAGAGACTCCTTTACAGGGCATGGCGCATGCCCCCAAAGCCTTCATCGGCGCACACTATGTATATGAA
ATGTCGCAAAAATATTGAAATCAAGCGGCGGGACTTGATTCCTAGGACCTCGGTCGATGCTCGAATCATTCAGGCTTCCCAGCAGCTTCCATCATCGCCT
TCGCTTGGATCAGCTTCTCAATGCGACTCACAATCTCAATGACCATGTCCTCCAGGCTCAAAGAGTCGATGCTGCTGTAGCCTAGCTGAGAAGCCACGTT
CTGTACTGAAACAGTAACATCAGAAACTGCATACCGCTCTTTCAGATCATCATAACGCTGACGGAGCTTTGCCATTGCCTGAGAAAAGGAATCAGGGTCT
GAAATAGCTTGTGCTCCCTTGCTCTTCAACATATCGTTCACGGCTAATTCGAGAGGGACATCGATCCAGATGGAGACTCCATGCCTCAGTAGCCCTAAGT
TGGTGGAGTTCATGACGGCGCCATCGCCACAGCAAAGCACGAGGCTGCCCATGGGACGTGAGCTGCTTCAGCCCCTCGGTCTCGACTTCGAGGTAGCCTT
TCTCGTCGGACTCCCGGAAGGCGGCGAGGGCGTCCTTGCCGCCGAGGACGTCCTCGAGCAGGTCCTCGCTGCAGAGGTAGCGGTAAATGATGGAGTTGGC
GAGCAGCTTGGCGATGTTGCGCTTGGCATTGCAGTCCGTCCCGACGATGTAGATGGGCGTCTTCCTGAAATCGCCGACGGCCTCCGCGGTCTTCCTGAGC
AGTGCGACGGAGGGGTTGAGCTCCTCGAGGGTGAGCTCGGTGGCTGGGAAGGCGCGGAGGCGACGGGGATCGATACGGCGGGTGGAGCCGCGCCGGGGGG
AGAAGACGGAGTGCGTGTGCTGCTGCTTCGGGCTCGGGGAGACGGAGGGCGAGAAGAAGGCCGCTGCCGCCCGCATCGCCATCGCCATTGCCGCTTCGAC
CGACCTC
page-top