Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig828
Contig Information
Length 719 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhva13b11    rwhva2g03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit proliferation-associated protein 2G4 [Zea mays]
Score 678
Evalue 1.94384e-69
Total Hit Count 313
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig828
CGGATTATAAGCATTACTGACAGGGTAAACATTCAGCACACCATACATAATTATCAGGCTTGTACTTCGATGTGATGTGCGCCAGGATCAACCATTTTCA
TTAGACACTTCAAAAAAAGGTACTCAAATCCCCACAGCTGAATGTAATATAAAACAATCAGATGCAGCAAAGGAGCAGGTACAAACGTAACGGAAGCAAT
TCAAAAAAAATGAGAATTATTCCTGGCTTGGTGCGTCCTTAGAAACCTCCATGGGCTCTGCTACTTCTGCTGCATCTCCTTTCTTGCCTTTCTTTTTCTT
GCCACCACCCTTCTTCTTTGACTTTGTGCCCAAAGCCAGCCAAGCCTTGATCTCAGCATCGCCCTCGATGGATTTTGAGGGCTCCAATTGCTGTAGTGGA
TGTGAAGTTATCTTGTCAGACCCATTTGGCATCAACAACACGGTGAACTTGATGTGGGCAACCAGGTCACCTTGCTTCTCATGTAGAACAGGGTATGGCT
GCAACAGCTCATGATTCATGCATTCTACCAAACCTAAGCGTGCACGCTTCTCCTCCAGCGCCCTAGCAGTGAATGGCATGATTGGGAACTTCTGGCTAAT
CTCACTGAAGATGAACCTTGATGCCTTCATCTTCAAGTGATAGTTCTTGTCTACAGCTCTCTTGTAAATAGTGGTCTGCTTCTCATCCAATAGCTTCGGC
TTTCCCTCGCCAGTGCTGG
page-top