Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig803
Contig Information
Length 722 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11b07    rwhva11b07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group] >gi|215740449|dbj|BAG97105.1| unnamed protein product [Oryza sativa Japonica Group]
Score 198
Evalue 8.95045e-14
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig803
AACCTGCAATACCAGTGCTTGCCAAAAACCGCTCAGCTGCTTGCTGACAAGTGATAAGCTTCTCGGTCCATTAATCGGTCGACCCGCGTCTGGTGAAGAT
GGGGAGGGCGAACTGCTCGGTTCCTCTCCTGGTGTTGCTGGCCTTCCTCTCCTGCTTCTTCCTCGCACACGCGGCGGTGGCCGGGGCCGGCGGCAACCGC
AAGATGTTCCTGCCGAGGGAGGGAGCGGCAGCCGCCGCCGTGTCCGACGATGGTGGGCAGGCGATGCCGACGACGGCGGAGGAGGTGGCGGTCGGAGGAG
AGATGCATCTGCTGCTGAGCGACGACGAGGAGATGTTGGCCAGGAGGGTGGACCTGCAGACAGAGGACTACCCGGGGTCCGGGGCCAACGGCCGCCATGA
TCCACGAAACCCGCATTAAGAGTTATTATGCCGTGCTGCATGTACGATAAGTGCATGTAATTAACCGCATGTTTAGTTACCCCCACAATCATGCATAATT
AAGCATATATATCATCACCACGTTGCTAAACATCATGATCTTAATTTAATTTGCTAGTGTATGCATCTTTGGTTGATAATAACAAATACTCCCTTCTTAA
ACTAATATATAAGATCGTTTAAATAGGGATCTAAACGATCCTATATTAATTTATAGAGGGAGTAGTTGTAGTCCCTATAGCTTGGGATTAAGCATGTTTC
ATCTCTGTCATCAAAAAAAAAA
page-top