Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig758
Contig Information
Length 782 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11b21    whva11b22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to FAT tumor suppressor 1 precursor [Strongylocentrotus purpuratus]
Score 87
Evalue 0.777629
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig758
TACATTTCTACTGTTCTTTGTTCCCTTTGAGGTTCACTGACTCAATTATGCATGAGATATGATATCAATTACTGCTTTGTGACAAGAATAAGCATGTGTC
TTTCTGTCTACAAACTTGTGGTTAGTGCCGTAGTGATGATGATCTAACTAGCTTCCTGTTTTCAGGAATGAAGATCTGAATTACCCTCAACCCTCTACAG
AAATCAGTTTACTCATTCAGTTTCTAGAACTTCTTTATAGCTTTCTGAGTTTACTTCGGTCTTGCATGGATTAGCTTTCTGTTTGTACCCCTATCTATTT
CTGTTTCTTTGTGTGTTTCTTATGTGCAAGTGCTCCATTGTGTGTGTCTTGACTGTGTGTCTGACTGTGTGTGTGTGATGTGCCCCTATCTATGTATGTT
TCTTTGTCTGTTTCATGTGTGCAAGCACTCCACTGTCTGTGTGTGACTGTGTTTGACTGCTTAGATGGGGTGATTCTGATTGTGTTACTGCTTATATGGT
CTGCCCAATTGGTTTCTTCTTCATGCTTTGCTTGTGTTCCAGTGTCGTCTCCCCATGTATGGGGATGTGTTGAGGGATGCAAACCATGTANGCCGTTTCG
AGCAGGCACGAATCCAGAGACACTGGTCAGGCTTCTCTCCTGCTGATANATGATGATAGGCTAANCGGAAAAGTTTGATTCTTGTAACACTCACTTGCTT
GGCTTCCACTCCTTTGCGTGGCCGATTTGGCATCCAATGCNATCCCATGCCCCTTTTCCCTGNTTATCTCACTCACTCATCA
page-top