Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig691
Contig Information
Length 695 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva15b07    rwhva15b07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_005128 [Oryza sativa (japonica cultivar-group)]
Score 537
Evalue 4.0283e-53
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig691
TCGTGCCGGGAAGAGGCCCTATGGTGTCGGTCTCCTTGTTGCGGGTCTAGATGAGTCTGGAGCCCATCTCTACTACAACTGCCCCAGTGGGAACTACTTT
GAGTACCAGGCATTCGCCATTGGCTCCCGCTCCCAGGCAGCGAAGACTTACCTCGAACGCAGATTCGAGAAATTCAACGCCTACACCCCGGACGAGCTCA
TCAAGGATGCGCTCTCAGCCATAAAGGAGACCCTCCAAGGTGAGAAGCTGACCAGCTCCAACTGCACCATTGCCATTGTCGGCAGAACGGAGGATGGCAC
CGTCGAGCCCTTCTCCATGATTGACTCCAAGAGGATCCAGGAAATCATCGACTCCATGGAGGCCGCCGATGAGGCGCCAGCGGCCGACGCCCCTGCTGAA
TCAAGCTCGATGCAGGAGGACAGGGGCGATGCGCCTGCGGCAGGGGATGCCCCAGCAGCGGATGAGCCGGCAGCACCGGACGCACCGGCACCCATGGACA
TCTAGGCGTCTTCTGATGATCTATACATGTCATGTCCGTCCACCCCCATTGCCGCAGCGCTATTCAGAGTTTCAAAAAGACTAGACTGTTGTTTTAGAAA
GGTTGCCATCCATTGTGTGTACTCTTTGCTTACTGTGCCACTACAGCTTTGTGGTGCCTGCGTCTGGACTGATTGATTTTTATCTAAAAAAAAAA
page-top