Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig690
Contig Information
Length 519 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva15b17    rwhva15b17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit tubulin alpha-6 chain [Zea mays]
Score 404
Evalue 5.14638e-38
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig690
AGGCGGAGGAAGGCGGCCAAGGGGGAGAGGCGGGGAGGAAGCGCGGGGTCGGTGCGGCGGCGGCGGAGTTCGAGATGGCTGCGGCCGGGCCGGACGGGCA
GAGAGAGCGGTCCATGGCGCTCAACAGCGAAGGCCTTGAGGGTCTAGTACCACGGGCAAAGCTGTTACTATCACTTGGTGGTACTTTTTCCCTGGCATTT
GGTCCTCTGATTATTGTCACGGTTTCTCTATTTGCTGGTCTTTATCTGTATTTTGGGCAAAGCTTTGTACATGACGGGAGCAAGAAACCAGTGGCGCCAC
CACCATACATTGATCCATATGAGCTACTGGAAGACGATATGATCTCCCGGCCCTCCCTTGATGTGTTCTGAATCTCCACGACACAAGGATAGTATTTGTA
GATAGCTCAATAATTTTCTTGTTTTACTAGATATGTACCTGTAAATGCAATAGCTGTAGACTGTTATTATCTAAAACTTTACAATAAAATTTGCGAAAAA
TCTCGCGCCAAAAAAAAAA
page-top