Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig688
Contig Information
Length 208 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva15c01    rwhva15c01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Serine/threonine-protein kinase SAPK2; AltName: Full=Osmotic stress/abscisic acid-activated protein kinase 2 >gi|218200043|gb|EEC82470.1| hypothetical protein OsI_26911 [Oryza sativa Indica Group] (no hit)
Score 671
Evalue 3.02568e-145
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig688
ATGCCAACTTGAATATGAACTAGGCGATGATTATGTACATCCAGTTTGATCAAGTAAATATTGTGACAGACTAATAATGGTAGCTAAGATTCATTCAAGT
AAATAATTTGATAGACAAATAAGTAGGTAAGATACATTCAATCAACGTGACACTACAACAGCGCATGTATATCGAAAGAGAAAAATAGTTTATCACTTAA
AAAAAAAA
page-top