Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig681
Contig Information
Length 817 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva15d06    rwhva15d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein CC1G_04032 [Coprinopsis cinerea okayama7#130] >gi|116507868|gb|EAU90763.1| hypothetical protein CC1G_04032 [Coprinopsis cinerea okayama7#130]
Score 85
Evalue 1.43364
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig681
ACGAATCAGCTCGGCGCCCGCCGCGCGCTCCATCGTGCAGAACGTGGGCGAAAAGTGAAAACCAAGCCGCCAATCCATCCCCCTCTCCCTCTCGTCCCGA
CCCCTGCCTCGCGCAGCCGCCTCGTCTCTCCTCCCCTCTCCCTCGTGTTCTCTCCCACGCCGCTGGCCCTCTCTCTCGCCTCAGCCGCCTCCTCTCCTCC
CCTGCGCCGTCGGCTCCCTCATCCTGCTTCTTCCTCCTTTCCGTCGGCGGCAGTGGTAACTGGTGAGCATGGGAGCAGCGGCTGCGGCTGGACGCCGTGA
GCTCGGGAGCAGCTTGTTGAGATGGTCCAAGTTGGGAACGACCAAGGCAAGGAGGATCAAGATCTGGATGGCACGCCTCACCCTCGGCTACCTCTTCCAC
CTCCCCGTCGACTGCCACTTATCACGGAGGAGGAAGGGATGGAGAGATATGGCGGCTGCGACTGGAGCTGGCGGATGCCAGATAGAGGTCCACCCTGTTC
CCGGCCTCCCGCGTCCCGCCCCGGTACAGGGGCAACGGCAAGGTGAAGATCGTCATGCCCGGAATTGGGCTCGGTGATGAAGGGCAAGCGAGGTTCCTAC
CCATGGGCTCCGGCAAGGCTCTCACTGATGGATTTGCAGTATGCCTAATCTTGGACGTGTGCAAACCAACATAGTTGTGAATGAGCTCTGCTAGATTGTC
TCAGCTCATGCCATGAGCTTTGGTAGTGTGTCACTGCAATGCGTAATGTCCATTCCTTCTGCCTTTTTCCTTTCTGTACATTTGGAGAAAAATGCACACA
TGTTATTTCTGCATTTG
page-top