Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig680
Contig Information
Length 1326 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva15d20    rwhva15d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_017556 [Oryza sativa (japonica cultivar-group)]
Score 931
Evalue 2.4355e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig680
ATTTCTCTCTCGCAGGCCCGACGCGACGCGACCCCCTCCCCTCCCTAATCATTGATTGATTGCCCCTCGCTCGACCGGGCCGAGGTTTCTCCCGCCGGCG
AGGAGCGGGCCCGCTCGCGCGCAGACAGAATCCGGTCTGAAGGGCGGTTTTGCTCGGCTCCGGCTCGGTGTGTTTGGTGGATCGAGGGGATGGAGCGGCG
GCGGTGGCTGCAGGCCGCGGTTCTAATGTGCTTGCTGCTGCTTTGCTCCGGGAGAGAACTTAAGAACAAAAGACAAGCGCCAGCATATAATTCCACTCTC
GCCAAGACGCTTGCAGAGTATACTTCAGCAGTTTATACTAATGACCTGTCACAGTTATTCACCTGGACCTGTGAAAAATGTGGTGACTTAACGGAGGGGT
TCGAGGTGATCGAGCTGATTATTGATGTGAAAAATTGCTTGGAGGCATATGTCGGTTTTGCAAGTGACATGAATGCTGTTGTAGTTGCATTCAGAGGGAC
TCAGGAGAACAGCATCCAGAATTTGGATTGAGGACTTATTTTGGAAACAACTTGATTTTGACTATCCCAGGCATGACTGAAGCAAAGGTGCACAGTGGGT
TTTATTCTGCATATCATAATACAACATTGCGTGATGGAGTCATCAATGGCATCCAGAAGACCAGGGAAGCATATGGCAATATTCCCATCATGGTGACAGG
ACATTCCATGGGAGGGGCCATGGCTTCGTTTTGTGCCCTTGATCTAATTGTTAACTATGGGGTTAAAGGACGTGACCCTGCTGACATTTGGGCAACCTCG
GATTGGTAATGCTGTGTTTGCTTCCCACTTTAAGAAATACTTGCCAAACGCAATTCGAGTTACCAACGCACATGATATTGTGCCTCATCTACCCCCGTAC
TACCAGTACTTCCCACAGAAAACCTACCATCATTTCCCACGAGAGGTATGGGTTCATAATATTGGACTCGATAGCCTAGTATACCCGATCGAGCAAATCT
GTGACGATTCTGGTGAAGACCCCACTTGCAGCAGGATCGTCACGGATGACAATATGCTCAGGCACAAAGTTGACACTGTAGACGGTGCTATTGTCTTCTC
GAAGCAGCCTGGTTTATCAGTTGATCAGCTACTCAGTACACAGTAAACAAGCTCAAGATTACATGGATTTATTTTGATGGTTCTTTTTTTTTCCAAAGTA
CAATATTCTTGTTGGCAATCAAAGCACTATCTCATGTATATATACGCGCGTGATCCTGGCTGGATTAAATTGTCCTAGCTGAGGGTGTATTTCTGAAGTG
TACAAACATATTTATGCTGATTAACT
page-top